BIS101—002&003 BIS101—002&003
Answers to Assigned Problems
May 9, 2016
Week 7 Study Questions from the textbook: Chapter 12- 12.5, 12.6, 12.10, 12.13, 12.20, 12.25, 12.34
12.5 (a) Why is the genetic code a triplet code instead of a singlet or doublet code? (b) How many different amino acids are specified by the genetic code? (c) How many different amino acid sequences are possible in a polypeptide 146 amino acids long?
ANS: (a) Singlet and doublet codes provide a maximum of 4 and (4) 2 or 16 codons, respectively. Thus neither code would be able to specify all 20 amino acids. (b) 20. (c) (20)146 .
12.6
What types of experimental evidence were used to decipher the genetic code?
ANS: Synthetic RNA molecules (polyuridylic acid molecules) containing only the base uracil were prepared. When these synthetic molecules were used to activate in vitro protein synthesis systems, small polypeptide containing only the amino acid phenylalanine (polyphenylalanine molecules) were synthesized. Codons composed only of uracil were thus shown to specify phenylalanine. Similar experiments were carried out using synthetic RNA molecules with different base compositions. Later, in vitro systems activated with synthetic RNA molecules with known repeating base sequences were developed. Ultimately, in vitro systems in which specific aminoacyl-tRNAs where shown to bind to ribosomes activated with specific mini-mRNAs, which were trinucleotides of known base sequence, were developed and used in codon identification. 12.10. What is the minimum number of tRNAs required to recognize the six codons specifying the amino acid leucine?
ANS: Because of wobble wobble (Table 12.2), one tRNA can recognize both UUA and UUG codons for leucine. However, it takes two more tRNAs to recognize CUU, CUC, CUA, and CUG. Therefore, a minimum of three tRNAs are required to recognize the six codons for leucine. 12.13 Identify three different types of RNA that are involved in translation and list the characteristics and functions of each.
ANS: Messenger RNA (mRNA) molecules molecules carry genetic information from the chromosomes (where the information is stored) to the ribosomes in the cytoplasm (where the information is expressed during protein synthesis). The linear sequence of triplet codons in an mRNA molecule specifies the linear sequence of amino acids in the polypeptide(s) produced during translation of that mRNA. Transfer RNA (tRNA) molecules are small (about 80 nucleotides long) molecules that carry amino acids to the
1
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
ribosomes and provide the codon-recognition specificity during translation. Ribosomal RNA (rRNA) molecules provide part of the structure and function of ribosomes; they represent an important part of the machinery required for the synthesis of polypeptides. 12.20. Assume that in the year 2025, the first expedition of humans to Mars discovers several Martian life forms thriving in hydrothermal vents that exist below the planet’s surface. Several teams of molecular biologists extract proteins and nucleic acids from these organisms and make some momentous discoveries. Their first discovery is that the proteins in Martian life forms contain only 14 different amino acids instead of the 20 present in life forms on Earth. Their second discovery is that the DNA and RNA in these organisms have only two different nucleotides instead of the four nucleotides present in living organisms on Earth. (a) Assuming that transcription and translation work similarly in Martians and Earthlings, what is the minimum number of nucleotides that must be present in the Martian codon to specify all the amino acids in Martians? (b) Assuming that the Martian code proposed above has translational start-and-stop signals, would you expect the Martian genetic code to be degenerate like the genetic code used on Earth?
ANS: (a) Two nucleotides in all combinations of four (2 4) would produce sixteen codons. Therefore, the minimum number of nucleotides comprising the Martian genetic code must be four. (b) Sixteen codons would allows code words for 14 amino acids, one initiation codon, and a translational termination codon. The Martian genetic code could not be degenerate. 12.25 The human !-globin chain is 141 amino acids long. How many nucleotides in mRNA are required to encode human !-globin?
ANS: 426 nucleotides—3 " 141 = 423 specifying amino acids plus three (one codon) specifying chain termination.
12.34 The following DNA sequence occurs in a bacterium (the promoter sequence is located to the left but is not shown). 5'-CAATCATGGACTGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCTGACGGTACGAAGTATACTTATCAACTGTA-5'
(a) What is the ribonucleotide sequence of the mRNA molecule that is transcribed from the template strand of this piece of DNA? Assume that both translational start and termination codons are present. (b) What is the amino acid sequence of the polypetide encoded by this mRNA? (c) If the nucleotide indicated by the arrow undergoes a mutation that causes this C:G base pair to be deleted, what will be the polypeptide encoded by the mutant gene?
2
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
ANS: (a) 5′-CAAUCAUGGACUGCCAUGCUUCAUAUGAAUAGUUGACAU-3 ′ (b) NH2-fMet-Asp-Cys-His-Ala-Ser-Tyr-Glu-COOH (c) NH2-fMet-Asp-Cys-Met-LeuHis-Met-Asn-Ser- COOH.
Additional questions on Chapter 12 material: *1. Consider the translation of the following mRNA sequence: 5’- …AUGCAGAUCCAUGCCUAUAGA… - 3’ a) Diagram translation at the moment the fourth amino acid is added to the polypeptide chain (your drawing abilities are not being evaluated here, do the best you can!). Show the ribosome; label its A, P, and E sites; show its direction of movement; and indicate the position and anticodon triplet sequence of the tRNAs that are currently interacting with the mRNA codons. b) What events occur to permit the next tRNA to interact with the mRNA?
ANS: a) Assuming translation started at the first AUG, the reading frame is AUG CAG AUC CAU GCC UAU AGA…, which codes for the polypeptide Met-Gln-Ile-His-AlaTyr-Arg-…. The fourth amino acid is His, which is added to the Met-Gln-Ile polypeptide by transfer of the peptide from the peptidyl tRNA in the P site to the amino-acyl-tRNA in the A site.
b) Currently, the E site is empty, the P site contains an uncharged tRNA, and the A site contains the growing polypeptide-tRNA. Next, the peptidyl tRNA in the A site of the ribosome will be translocated to the P site, and the uncharged tRNA in the P site will be translocated to the E site, as the ribosome moves 3 nucleotides toward the 3’ end of the mRNA. The translocation of the ribosome is catalyzed by EF-G and the energy of GTP
3
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
hydrolysis. The translocation of the peptidyl tRNA from the A site to the P site leaves the A site unoccupied. As the next codon is GCC, the A site will next bind tRNA Ala. *2. An experiment by Khorana and his colleagues translated a synthetic mRNA containing repeats of the trinucleotide UUG (…UUGUUGUUGUUGUUG…). a) How many (triplet, nonoverlapping) reading frames are possible in this mRNA? b) What is the result obtained from each reading frame? c) How does the result of this experiment help confirm the triplet nature of the genetic code? ANS: a) Three reading frames are possible (5’-UUG UUG UUG…-3’, 5’-UGU UGU UGU…-3’, and 5’-GUU GUU GUU…-3’). b) translation of 5’-UUG UUG UUG…-3’ produces polyleucine (Leu). Translation of 5’UGU UGU UGU…-3’ produces polycystine (Cys). Translation of 5’-GUU GUU GUU…-3’ produces polyvaline (Val). c) The result differs from that predicted for nonoverlapping doublet or quadruplet codes, both of which predict a single type of polypeptide composed of repeats of two, or three amino acids. Only a triplet code is predicted to produce three different single amino acid polypeptides from the given mRNA.
Chapter 13- 13.2, *13.15, 13.16, 13.22, *13.26, 13.28, 13.29, 13.31, 13.37
13.2. Of all possible missense mutations that can occur in a segment of DNA encoding the amino acid tryptophan, what is the ratio of transversions to transitions if all single base-pair substitutions occur at the same frequency?
ANS: 6:1 UGG transitions UGA (nonsense), UAG (nonsense), CGG (Arg). UGG transversions UGC (Cys), UGU (Cys), UCG (Ser), UUG (Leu), AGG (Arg), GGG (Gly).
13.15 If CTT is a DNA triplet (transcribed strand of DNA) specifying glutamic acid, what DNA and mRNA base triplet alterations could account for valine and lysine in position 6 of the #-globin chain?
ANS:
4
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
13.16. The bacteriophage T4 genome contains about 50 percent A:T base pairs and 50 percent G:C base pairs. The base analog 2-aminopurine induces A:T → G:C and G:C → A:T base-pair substitutions by undergoing tautomeric shifts. Hydroxylamine is a mutagenic chemical that reacts specifically with cytosine and induces only G:C → A:T substitutions. If a large number of independent mutations were produced in bacteriophage T4 by treatment with 2-aminopurine, what percentage of these mutations should you expect to be induced to mutate back to the wild-type genotype by treatment with hydroxylamine?
ANS: About half of the induced mutations would be expected to mutate back to the wildtype genotype. 13.22. One person was in an accident and received 50 roentgens (r) of X rays at one time. Another person received 5 r in each of 20 treatments. Assuming no intensity effect, what proportionate number of mutations would be expected in each person?
ANS: The person receiving a total of 100 r would be expected to have twice as many mutations as the one receiving 50r. *13.26. You are screening three new pesticides for potential mutagenicity using the Ames test. Two his strains resulting from either a frameshift or a transition mutation were used and produced the following results (number of revertant colonies): $
5
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
What type of mutations, if any, do the three pesticides induce? ANS: P #1 – Causes transition mutation. Liver enzymes convert it into nonmutagen. Does not cause frameshift mutations. P #2 – Does not cause transition mutations. Liver enzymes convert it into a frameshift mutagen. P #3 – Causes transition mutations. Liver enzymes have no effect on mutagenicity. Does not cause frameshift mutations.
13.28. Sydney Brenner and A. O. W. Stretton found that nonsense mutations did not terminate polypeptide synthesis in the rII gene of the bacteriophage T4 when these mutations were located within a DNA sequence interval in which a single nucleotide insertion had been made on one end and a single nucleotide deletion had been made on the other. How can this finding be explained?
ANS: The reading frame will be shifted between the two frameshift mutations. This shift in reading frame does not read the normal nonsense codon and termination does not occur.
13.29. Seymour Benzer and Ernst Freese compared spontaneous and 5-bromouracilinduced mutants in the rII gene of the bacteriophage T4; the mutagen increased the mutation rate ( rII + —> rII ) several hundred times above the spontaneous mutation rate. Almost all (98 percent) of the 5-bromouracil-induced mutants could be induced to revert to wild-type (rII —> rII +) by 5-bromouracil treatment, but only 14 percent of the spontaneous mutants could be induced to revert to wild-type by this treatment. Discuss the reason for this result.
ANS: 5-BU causes GC <—> AT transitions. 5-BU can, therefore, revert almost all of the mutations that it induces by enhancing the transition event that is the reverse of the one that produced the mutation. In contrast, the spontaneous mutations will include transversions, frameshifts, deletions, and other types of mutations, including transitions. Only the spontaneous transitions will show enhanced reversion after treatment with 5BU.
6
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
13.31. Mutations in the genes encoding the ! and # subunits of hemoglobin lead to blood diseases such as thalassemias and sickle-cell anemia. You have found a family in China in which some members suffer from a new genetic form of anemia. The DNA sequences at the 5 % end of the nontemplate strand of the normal and mutant DNA encoding the ! subunit of hemoglobin are as follows:
Normal 5 ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA……-3 -
Mutant 5-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3 (a) What type of mutation is present in the mutant hemoglobin gene? (b) What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? (c) What are the amino acid sequences of the normal and mutant polypeptides? ANS: (a) Frameshift due to the insertion of C at the 9th, 10th, or 11th nucleotide from the 5% end. (b) Normal: 5 %-AUGCCGUACUGCCAGCUAACUGCUAAAGAACAAUUA-3 %. Mutant: 5%-AUGCCCGUACUGCCAGCUAACUGCUAAAGAACAAUUA-3 %. (c) Normal: NH 2-Met-Pro-Tyr-Cys-Gln-Leu-Thr-Ala-Lys-Glu-Gln-Leu. Mutant: NH2-Met-Pro-Val-Leu-Pro-Ala-Asn-Cys. 13.37. Would you expect nitrous acid to induce a higher frequency of Tyr → Cys substitutions? Why?
→ Ser
or Tyr
ANS: Tyr → Cys substitutions; Tyr to Cys requires a transition, which is induced by nitrous acid. Tyr to Ser would require a transversion, and nitrous acid is not expected to induce transversions.
Study Questions from the literature:
Crick et al, 1961. 1. Outline the experiment and major results of this study in your own words. ANS: As stated in the question, this should be in your own words. They began with a T4 phage mutant for the rII gene, where the mutation caused a single base-pair addition, and thus this phage was unable to infect bacteria and make plaques. They added additional mutations to this original mutant phage, which caused single base pair insertions or deletions, and examined whether and in what combination additional these additional mutations were able cause a reversion (i.e. restore wild type function) in the phage. What they observed was that adding a single deletion to their original mutant with a single insertion caused reversion. Adding an additional insertion to their original mutant with an insertion (for a total of 2bp inserted) did not cause reversion. When they
7
BIS101—002&003
Answers to Assigned Problems
May 9, 2016
added two additional insertions to their original insertion (for a total of 3bp inserted) they observed a reversion. From these experiments, they were able to observe that: - The genetic code is a triplet code. Three base pairs in the mRNA specify an amino acid. Because an addition of a total of 3 base pairs is able to restore wild type function of the phage (where as the addition of one or two bases is not) the code must work in threes. -The bases are read from a fixed starting point, and there is no “punctuation” to indicate what the right codons are. Because the addition of one base the reading into triplets is incorrect, meaning that the reading frame is thrown off, thus causing a frameshift. From previous studies, they knew: - The genetic code is not overlapping. A mutation in a gene that affects only one base pair in the DNA only affects one amino acid in the protein encoded by that gene From simple calculations they propose: - The genetic code is degenerate. They make the observation that there are 64 combinations of the four DNA bases in a three base pair codon (4 x 4 x 4). There are only 20 amino acids. Therefore, it must be that each amino acid is specified by more than one codon. 2. If the genetic code had turned out to be a non-overlapping quadruplet code (4 bases per amino acid), how would their results have changed? ANS: Their experiments started with a T4 phage with a single base pair insertion in the rII gene, which had an rII- phenotype, and added additional insertions or deletions to that strain. If the genetic code was a quadruplet code, they would not have observed reversion to rII+ with the two additional insertions (for a total of 3bp inserted). Instead, it would have taken 3 additional insertions (for a total of 4 bp inserted) to restore the reading frame and the rII+ phenotype.
8
