Forensic Science New Print 2011

Simple Schooling Forensic Science ©2010

1


2


“Forensic Science” Is a Product of

TheSimpleHomeschool.com And

Simple Schooling

All contents copyright 2010 by The Simple Homeschool and Simple Schooling. All rights reserved. The original purchaser does NOT have any resale rights to this digital media. Original purchaser may print and copy these materials for their immediate family only. No part of this document or the related files may be reproduced or transmitted in any form, by any means (electronic, photocopying, recording, or otherwise) to any other person without the prior written permission of the publisher. Limit of Liability and Disclaimer of Warranty: The publisher has used its best efforts in preparing this book, and the information provided herein is provided "as is." The Simple Homeschool and Simple Schooling make no representation or warranties with respect to the accuracy or completeness of the contents of this book and shall in no event be liable for any loss or other damages.

Check out all our Interactive Unit Studies and courses at our website.

3


4


“Forensic Science” Table of Contents

Unit

Page

1

What is Forensic Science

4

2

Intro to CSI

15

3

Intro to Death Investigation

26

4

Crime Scene Case Study

37

5

Documentation, Evidence, and Witnesses

48

6

Forensic Ballistics

60

7

Fingerprints

71

8

Introduction to DNA

82

9

Arson and Explosion Investigations

94

10 Trace Evidence

104

11 Death, Investigation, and Certification

115

12 The Autopsy

125

13 Entomology, Anthropology, and Odontology

136

14 Pharmacology and Toxicology

148

15 Drug Scheduling and Illegal Drugs

159

16 Prescription Drugs

169

17 Preliminary and Confirmatory Drug Testing

180

18 The Toxicology Report

192

19 The Legal System and Expert Testimony

203

20 Solving the Crime

213

5


6


Unit One – What is Forensic Science

7


8


Unit One – What is Forensic Science Everyone, at one time or another, has seen the science of forensics in action. Most of the time people see this unique and interesting field portrayed while watching TV, but few truly realize what forensic science is or what a “forensic scientist” does and does not do. Forensic science is a very broad term used to describe the methods used to make sense of a criminal event. Literally speaking, forensics comes from the Latin word forensis, which means “before the forum.” The forum referred to here is the ancient Roman marketplace which was used not only as a place to purchase things, but as a place for the community to gather to conduct business. If a person was accused of a crime they were brought before the forum to present their case. Often the criminals would have representatives, much like lawyers, to present their cases for them. The art and science of public speaking, rhetoric, and logic were used during this presentation and the person who made the best case won. Today the term forensics is used to specifically pertain to the legal system and Forensic science is the actual act of gathering and interpreting that evidence. Then the evidence is presented to a jury or judge in order to persuade them that an act has or has not taken place. Listed below are the many different forms that forensic science can take, along with a brief explanation of each one. Forensic Accounting – the forensic account will gather evidence pertaining to accounting methods to try and figure out a money trail.

9


This type of forensics is often used during tax audits or a criminal investigation involving money hidden overseas. Computer Forensics - the forensic computer specialist will find or reconstruct digital media such as graphic images, files, or folders contained on a hard drive or disc to use in the court as evidence. This is a very common form of forensics and almost every case can expect to involve some sort of digital reconstruction. For example, when investigating a missing person, their e-mail and personal computer can be accessed through a court order so information about a suspect can be obtained. Forensic Document Examination - this field deals mostly with handwriting analysis and or establishing a “fingerprint” of sorts on a printer or typewriter. Forensic Dentistry – is used to establish identity for fire or drowning victims, victims of natural or catastrophic disasters, or victims who are no longer recognizable for any reason. Forensic Economics – is used in personal injury cases where an accident has cost a person benefits or actual pay. It can also be used to assess business lost, future medical expenses, and future labor. Much of this falls under the category of compensatory damages.

Forensic Engineering – is used to reconstruct buildings or mechanical devices after malfunction or collapse to see if the design was flawed. Forensic Psychology and Psychiatry – is used to evaluate defendants or witnesses and establish that they are able to stand trial or deliver testimony. It can also be used to determine a motive in some cases. It is a subjective rather than objective science. That means that an 10


expert’s opinion is used instead of factual data. These opinions will almost always have a counter opinion presented in court which states the exact opposite. Forensic Anthropology – is used to reconstruct human or non-human remains for the purpose of establishing a timeline or events. Criminalistics or Crime Scene Investigation - is used to describe the act of gathering physical evidence relating to any part of the crime at hand. It can include, but is not limited to, fingerprints, blood, blood spatter patterns, weapons, bullets, hair, fibers, paint, glass, and tire or shoe tracks. Forensic Serology – involves the analysis of bodily fluids collected during a Criminalistics investigation. It can include blood, semen, saliva, sweat for the purpose of identification of an individual involved in a crime. Forensic Biology – is a broad term used to describe a combination of fields such as forensic anthropology, forensic dentistry, forensic serology, forensic entomology, and forensic botany. Forensic Entomology - is used to help determine the time and location of death based on the type of insects found near, on, or in the body. Forensic Pathology - is the use of an autopsy performed by a medical examiner to determine specific cause of death and injury identification. The end result is the signing and issuing of a death certificate. Forensic Toxicology - is the study, evaluation and identification of the effects of poisons, chemicals, or drugs in and on the human body. 11


Almost any science can be used in a “forensic” manner because forensics means to use in the legal process. For example, if certain weather conditions were present during a crime, a criminalist might look to a meteorologist to help establish a timeline. In that case, the meteorologist would be employing forensics to his specialty field. In this course, you will be learning about the two most common forms of forensics; Crime Scene Investigation and Death Investigation. As you move through the course you will come to understand that each and every one of these unique disciplines are intertwined to form the final conclusion. In addition you must always remember that ultimately, all evidence will be presented in front of a jury and/or judge for final consideration so it is imperative that certain legal procedures maintain priority at all times. These requirements include several aspects, but the primary concern is the chain of custody. Chain of custody is a term used to describe the “beginning to end” paper trail of each individual piece of evidence collected. A lawyer must be able to prove that the evidence presented to the jury and judge was tracked from the time it was collected, to the end of the analysis by an expert specialist. Any act which results in the breaking of the chain of custody will significantly damage the prosecution of the case and might involve letting a guilty person go free on a “technicality”. Another thing you must keep in mind is that the CSI shows on TV give only half the truth. Blood and hair samples are never collected and 12


analyzed on the same day. DNA analysis is a touchy and complicated process which requires planning and expertise, forensic toxicology cannot find unusual chemicals on the first go round, and real time gathering and examination of the evidence in a methodical way requires patience.

Complete the exercises for Unit One on the following pages.

13


14


Exercises for Unit One Creative Thinking

Define the following terms: Forensic Economics-

Forensic Engineering –

Imagine a scenario in which both of these disciplines were used to solve a crime. What sort of crime would be involved? How would the two disciplines complement each other and lead investigators to proper conclusions?

15

Simple Schooling Forensic Science ©2010 Define the following terms: Forensic Anthropology-

Forensic Entomology –

Forensic Dentistry -

Imagine a scenario in which all of these disciplines were used to solve a crime. What sort of crime would be involved? How would the two disciplines complement each other and lead investigators to proper conclusions?

16

Simple Schooling Forensic Science ©2010 Define the following terms: Forensic Pathology-

Forensic Toxicology –

Imagine a scenario in which both of these disciplines were used to solve a crime. What sort of crime would be involved? How would the two disciplines complement each other and lead investigators to proper conclusions?

17

Simple Schooling Forensic Science ©2010 Define the following terms: Forensic Serology-

Criminalistics –

Forensic Psychiatry/Psychology -


18

Simple Schooling Forensic Science ©2010 Define the following terms: Forensic Accounting -

Forensic Document Investigation –

Computer Forensics -


19


20


Unit Two – Intro to Crime Scene Investigation

21


22


Unit Two – Intro to Crime Scene Investigation Upon entering a crime scene the issue in the forefront of your brain must be preserving evidence and chain of custody. The initial response is a “make it or break it” moment where casual slip-ups can spell defeat in the courtroom. In this unit you will learn the basic ins and outs of crime scene investigation, how first responders initially secure the scene, how investigators evaluate and preserve the scene, and how all personnel process the scene. All three areas are crucial to the success of the case and the prosecution of the guilty suspect in a court room. When thinking of a crime scene keep in mind that there will be a plethora of possible scenarios, such as domestic disturbances, murder, assault, bank robbery, hit and run, shooting, stabbing, kidnapping, and any number of other possibilities. You will not always be dealing with a death investigation and that is why these two subsets of forensic science are separated into unique units. You will however, always have to deal with the crime scene investigation and many of the same principles will be employed for both.

First Responders First responders are those who are initially involved with a suspect, a crime scene, or a victim. First responders include any law enforcement officer but will typically exclude rescue responders and fire fighters as their primary concern should be life-saving techniques. 23


Investigators are not normally the first responders unless the crime happens in their presence or they come across a scene in relation to the investigation of another case. The first responders shall: Approach the scene cautiously Assess the scene for dangerous situations Secure the scene if a dangerous situation exists Provide or call for emergency medical services Avoid disruption and contamination of the scene Secure access to, and control all persons, at the scene Identify, establish, and secure the boundary of the scene Brief and turn control of the scene over to investigators upon arrival • Document all actions and observations

• • • • • • • •

Evaluating and Preserving the Scene The first thing investigators do is assess the type of crime committed. This initial evaluation is not expected to be the final determination by any means, but it should pay close attention to detail and be able to lead the investigators to the next logical step. Mishaps in the initial assessment can cost the investigative team valuable time and cause loss of confidence in a jury when presented at trial.

Prior to the actual assessment the investigators will: • Talk with the first responder about the scene 24


• Evaluate all safety issues such as bloodborne pathogens, and other hazards • Consider if legal permission is necessary (search and seizure consents and search warrants) to start a full investigation • Establish a path of entry and exit to the scene to be used by authorized personnel • Evaluate the initial scene boundaries set up by the first responders • Determine the if there are more than one crime scene and then prioritize each one • Establish a consultation and equipment area near the scene • Talk with responders and investigators at any additional scenes, if they exist • Find a secure area for the short term storage of evidence making sure chain of custody is followed • Request more investigators and/or officers, equipment, and/or prosecutors if necessary • Document every person who enters and exits the crime scene • Identify and separate the witnesses • Search the immediate area and document findings • Photograph the scene to preserve evidence Once all the above activities have been established, the investigative team can start the assessment and evidence collection process. This includes two aspects; the walkthrough and the documentation.

The Walk-Through The walk through is the start of the actual investigation. This step will provide an overview of the scene and will make sure the physical evidence, such a blood spatter or a weapon, is protected from 25


contamination. At the same time, every part of the scene should be photographed/video tapes and documented in writing. Special attention should be paid to the prevention of contamination of the scene. Gloves should be worn to avoid leaving fingerprints and all pieces of evidence which could be perishable should be properly collected and stored at the appropriate environmental conditions, if necessary. The final step in the crime scene investigation is the processing of the scene. Processing of the Scene Processing is a term used to decide on how big of a team is necessary for the investigation, who will take on which role, whether any outside departments or agencies should be notified and brought in, decide what type of forensic analysis is necessary, and call for the specialized forensics teams to come do their part. Once this initial step is completed the teams arrive and collect the evidence. On the TV programs you will often see forensic specialists out at the crime scene. This is not typically the case. The pathologist doesn’t’ need to be at the scene to establish cause of death. He or she relies on the excellent documentation provided by law enforcement. Additionally, the DNA specialist does not leave the lab to go collect blood. Law enforcement specialists and/or medical personnel are trained for just that purpose and will perform the collection duties. In coming units you will learn about the specific types of evidence collected at the crime scene as well as the laboratory analysis. Evidence collected will include: 26


• • • • •

Bullets and firearm collection and ballistics analysis Fingerprint lifting and analysis DNA collection and analysis Arson patterns and flammable liquids Paint, glass, and fiber collection and analysis

As you can see the act of crime scene investigation requires a detailed oriented person who is able to perform a methodological and precise investigation according to procedure and law.

Complete the exercises for Unit Two on the following pages.

27


28


Exercises for Unit Two Vocabulary

Define the following terms and phrases:

1. Chain of custody –

2. First responder –

3. Evaluation of the scene –

4. Preserving the scene –

5. Walk-through –

29


6. Physical evidence –

7. Processing of the scene –

Short Answer Write a brief answer to each question

Why is chain of custody important?

What is the role of the first responder and how important is their contribution to the investigation?

How can the first responder make the investigation proceed smoothly?

30

Simple Schooling Forensic Science ©2010 How could they make the investigation more difficult?

What is the role of the investigator and what types of duties do they have?

What has to happen before the forensic teams can enter the crime scene to collect evidence?

Name three ways in which the crime scene could be contaminated.

Why is it crucial to control contamination?

What is the job of the DNA specialist and where to they perform these duties?

31


Research and Critical Thinking Use the internet to answer the following questions: If the first responder to a crime scene was a traffic officer, what sort of training is required to perform that job? How long would it take to become a traffic officer?

Name three possible scenarios (specific crimes) in which a traffic cop would be the first responder to a crime scene.

32

Simple Schooling Forensic Science ©2010 What sort of training is required to perform the duties of an investigator? How long would it take to become an investigator? What other jobs would you be expected to have performed before becoming a crime scene investigator?

Find three schools in your state, or surrounding states, which offer this kind of training and name them below.

Name three specific qualifications that a person should have in order to be a good investigator.

33


34


Unit Three – Intro to Death Investigation

35


36


Unit Three – Intro to Death Investigation Death investigation is the other half of the intriguing field of forensic science and is just as detailed oriented as the investigation of a crime scene. Of course, death investigation only occurs when there is a death and not all serious crimes end with that particular outcome. Those crimes that produce injuries will result in another type of investigation, but ultimately they both use many of the same analytical techniques. The two things that will not happen in the absence of death are the post mortem period and the autopsy. In many instances a medical examination at a hospital will take the place of the autopsy. This might also involve the use of a forensic psychologist and/or psychiatrist if there is emotional trauma involved. Keep in mind that a psychiatrist is a medical doctor, while a psychologist will typically have a Master’s Degree or a PhD in a specific field of counseling, such as children or families. This might not sound like a huge difference, but when presented before a court, the jury may be persuaded if one side has a psychiatrist and the other a psychologist. A psychologist cannot make a medical diagnosis. Always, always, always keep in mind that forensics involves building a case. You must always assume that everything you do in the field, and every decision you make will be presented in a court room for evaluation by a judge or jury. Everything must stand up in court or your investigation is worthless. That means you must follow procedure.

37


The death investigation begins with the crime scene investigation. Once the preliminaries are out of the way, personnel from the coroner or medical examiner’s office will arrive to remove the body. A side note here: There is a difference between a coroner and a medical examiner. A state will have one or the other but not both. A coroner is usually an elected official, is not a doctor, and relies on a pathologist to perform the autopsies. The medical examiner is almost always a pathologist and has a medical degree, oversees the office of the medical examiner, may or may not perform the autopsies himself, is appointed by an elected official. Which one is better? That is matter for debate. The important thing to remember is that only a pathologist, or trained personnel under the direct supervision of a pathologist, can perform an autopsy. In an ideal world, every coroner and medical examiner would be a forensic pathologist, but that is not always the case. A forensic pathologist is specially trained to perform a medicolegal investigation, or an investigation of death which is of legal concern. The Autopsy Not all deaths will need to be investigated but the following list will give you a good idea of when an investigation should and will take place: “Sudden, suspicious, unexpected and unexplained” deaths include the following: • Any uncertified death • Deaths from vehicular, aircraft or rail accident • Deaths occurring during employment (accident, disease, poisons) • Deaths due to poisoning (gases, drugs, etc.) • Suicides and apparent suicidal deaths • Deaths associated with anesthesia 38

Simple Schooling Forensic Science ©2010 •

• • • • • • • •

• • •

Accidental deaths at home or in hospital, institution or public place Deaths following an abortion or attempted abortion Deaths apparently caused by neglect (malnutrition, etc.) Deaths in custody (police, prison or secure hospital) Death of a newborn child Death (not in a house) where deceased’s residence is unknown Deaths by drowning Child deaths from suffocation Deaths from smallpox, typhoid or other reportable infectious diseases Deaths from fire or explosion Sudden death Violent, suspicious or otherwise unexplained deaths

Deaths occurring while under medical care are also subject to scrutiny. These include deaths which are: • Clinically unexplained deaths • Associated with lack of medical care • Associated with or during the administration of general or local anesthetic An autopsy is a postmortem examination involving the dissection of the body. The word “autopsy” is derived from the Greek “auto” and “opsis” (literally “looking at the self”). The purpose of the autopsy depends on the circumstances of the death. In the forensic setting an autopsy is carried out to primarily establish the cause of death. This is then put on record via the death certificate. The Post Mortem Period One of the most important pieces of evidence in any case involving a dead body is the obvious question - “when did the person die?” The 39


Sherlock Holmes method is to glance down at the smashed watch on the deceased’s wrist and to then proclaim that the time of death is the time shown on the broken face. Unlikely, gov’na! We must do things the hard way as the smashed wristwatch method rarely applies. The deceased body goes through many changes over a set period of time and these changes can be documented. You can estimate a time of death based on which stage of change the body is in. Some changes, like rigor-mortis, are biochemical and electrical, causing the muscles to stiffen, while others are induced by micro-organisms. The rate of most of them depends upon the temperature of the environment. A hot environment tends to speed up these changes and a cold one slows them down. Postmortem cooling, then, is the best method available and without an eye-witness to corroborate the time of death, the most influential person will ultimately be the forensic pathologist. Other factors in Death Investigation How did they die? Several methods are used to establish cause and time of death such as toxicology, entomology, pharmacology, and wound evaluation due to specific circumstances, such as fire or water. Each process and method of evaluation used for the autopsy and post mortem interval will be explored in detail in the upcoming units. 40


The Case Study In the next unit you will be presented with a crime scene case study. You will enter the scene as an investigator and all successive units will allow you to follow the crime to the final court decision where you will be both judge and jury. Did the investigative team get the right suspect? Was the chain of custody maintained? Were proper procedures followed during collection and evaluation of evidence? Does the evidence support the prosecution? Is the suspect guilty? Only patience and determination will tell! Complete the exercises for Unit Three on the following pages.

41


42


Exercises for Unit Three Vocabulary

Define the following terms and phrases: 1. Death Investigation -

2. Coroner -

3. Medical Examiner –

4. Forensic Pathologist –

5. Rigor-Mortis –

6. Autopsy –

43

Simple Schooling Forensic Science ©2010 7. Death Certificate –

8. Case Study –

9. Post Mortem Interval –

10. Post-Mortem Cooling -


What is the difference between a forensic psychologist and a forensic psychiatrist?

44

Simple Schooling Forensic Science ©2010 What is the difference between a coroner and a medical examiner?

How do forensic scientists determine the time of death?

Do you think this time would be exact, or would it require some guessing? Why?

45


Research and Critical Thinking Use the internet to answer the following questions: Use these sites or any site of your choosing http://www.deathonline.net/decomposition/forensic/timing.htm http://www.exploreforensics.co.uk/estimating-the-time-of-death.html

Post mortem cooling is a technique used to establish time of death. What exactly is post-mortem cooling?

Name a few of the methods used to calculate time of death.

46

Simple Schooling Forensic Science ©2010 What are the qualifications required to become a board certified forensic pathologist? Hint: http://www.forensiconline.com/generallink.htm#a10

What else is required besides school?

47


48


Unit Four – The Crime Scene Case Study

49


50


Unit Four – The Crime Scene Case Study As you have probably discovered, a case study is used to help people think critically about finding answers to questions. When using a case study you are expected to use ALL the information you have learned and APPLY that information to come up with a plausible answer or conclusion. You cannot be expected to get everything right, every time when answering case studies because people are not omnipresent. That means, we can never know ALL of the information available, and in many cases we actually have very few clues to go on. The people who most often rely on case studies to perform the duties of their jobs are: • Doctors and other medical professionals- who must fit clues together to make a diagnosis • Lawyers and other legal professionals who must fit clues together to persuade a jury and judge, and • Criminal Investigators who must fit clues together to understand a crime scene Critical thinking is a major component of case study work. A person who is successful at critical thinking can use learned information in combination with real life scenarios and experiences to form a conclusion. For example: Your little sister woke up with a stuffy nose, watery eyes, and a cough. What is your conclusion about her condition? 51


Your conclusion will take into consideration past experiences and learned information and ultimately lead you to the decision that your little sister has come down with a cold. In this scenario we used Symptoms to make our conclusion. You’ve experienced those symptoms before yourself, and you are pretty certain that she has a cold. Are you correct? Maybe. Maybe not. Perhaps her cough lasts for several weeks, does she still have a cold? Probably not. A case study conclusion can only be an educated guess. We use all of our information together with all of our past experiences to form a possibility. The same will apply to a crime scene. You will never have access to all the clues, nor will you always be able to interpret the clues yourself. You must rely on the past experiences and expertise of others in order to be a good criminal investigator. In both a case study and a criminal investigation you will be “given access” to certain information. Sometimes this information will set off a “light bulb” and you will immediately understand how it fits into the puzzle. Sometimes you will have no clue. When you have no clue as to what that piece of information means you have several options: • • • •

Wait for more information to be revealed Ask someone for help, like an expert Look for more information on your own Sleep on it 52


Does that sound funny to say sleep on it? Sometimes you have so much information going through your head that you cannot see the big picture, you only see the little pieces floating around. You cannot put the puzzle together. This is quite common when you have a lot of new information presented all at one time. If you give yourself time to sort through things, “sleep on it”, you will often find you have a new perspective the next day and can put things into place. In a criminal investigation you will find the following to be true much of the time: • You don’t have all the information • You don’t understand all the information • You are presented with many bits and pieces at once and feel overwhelmed • You will require expert advice to help you form a conclusion • You will be wrong at times • You will be frustrated • You will depend on your team • You will get great satisfaction when you fit the pieces together • Experience cannot be substituted with a case study So why do the case study if you cannot gain real world experience from it? That is the only way we have to prepare people for these critical jobs. Would you want a doctor that had never diagnosed anything to be YOUR doctor? Isn’t it better that the doctor had an opportunity to practice his critical thinking skills before being asked to apply them? This is why thinking through case studies is important. Plus it is fun! You will love the case study that will present itself in various units throughout the rest of this course, and you will surprise 53


yourself when you can take the information you learned from the course, and apply it to a “mock” investigation. You can expect the following issues to be presented in the case study: • • • • • • • • • • • •

A crime scene Securing the crime scene How to decide what is evidence Witness interviews Gathering evidence Analyzing evidence Dealing with suspects Present the case in a courtroom Calling expert witnesses Using scientific evidence and statistics Cross examination Jury point of view

You will learn about all the major types of evidence such as ballistics and firearms, blood analysis and spatter patterns, flammable liquids and arson, autopsies and death investigation, fibers, paint and glass fragments as evidence, entomology, pharmacology and toxicology, analytical methods used in the lab, how statistics, emotions, and expert witnesses can be manipulated for juries. On the next several pages you will be introduced to your case study crime scene. Not all pieces of information are important. Remember when you were first learning to solve word problems and there was extraneous information (information that wasn’t necessary) put into the problem to try and confuse you? In the case study you will find that not all information is equal. Some of it will count and some of it will be irrelevant. You might not be able 54


to determine which pieces are important immediately and will need to practice the four strategies listed in previous pages in order to make a determination.

Assignment: Look over your crime scene and look back to Unit Two about how to handle a crime scene. Make notes in the appropriate places about typical and/or unusual procedures. Answer any questions presented.

55


56


Exercises for Unit Four Case Study Introduction

On January 4th at 5:30 Am the Landlord at the Sunnyside Apartments called police to say that he had found his tenant, Miss Sally, dead on her couch. The Landlord had left his apartment around 4:10 AM so he could shovel the Fountain courtyard and spread magnesium chloride to melt the ice. He approximated that it took him about two hours to perform that task. The Landlord stated that he first noticed the open window to Miss Sally’s apartment when he went to the parking lot to shovel snow and put down magnesium chloride to melt the ice. Since the temperature outside was a bitter -10 degrees F he felt that this open window was “out of place” and wanted to investigate. He approached Miss Sally’s apartment at approximately 6:00 AM and knocked on the door. When she didn’t answer after several minutes of pounding and shouting, he let himself in and discovered her frigidly cold body on the couch, dead. Upon arrival at 6:15 AM, first responders assessed the crime scene, secured the suspected entrance and exit points (open window) and marked all possible clues with orange flags. Investigators arrived at approximately 6:45 AM, were briefed by the first responders, double checked the scene, and proceeded to perform a walk through one detective at a time.

57


Witness Interviews (In their own words) Landlord: I had gotten up at 4 AM, like I always do when it snows. My job is to clear the sidewalks and parking lots before people go to work. So I went out to the courtyard and stared shoveling, then I threw down some Mag Chloride to make sure that no one would slip on the ice. That took about two hours. Then I went to the parking lot to start clearing that out and that’s when I noticed Miss Sally’s window was open and the light was on. I peeked in and yelled her name but no one came. It was pretty strange to have an open window at this temperature, so I went around to the front to knock on the door. I like to look out for her because she is so young. She didn’t answer, so I pounded for a few minutes, yelling her name. No one came again, and so that was when I let myself in with the key. That’s when I found her. She was blue with cold and she was dead. I did try to do that mouth to mouth CPR stuff, but I only know how to do it by watching TV so it didn’t work. Maybe she died of the cold? I do think that there is one suspicious fact that might not be known. Joe, the baker who lives next door to her, had asked her out on a date last night and she turned him down. He’s always gone early in the morning to go to work. Maybe he had something to do with this? I never liked him because he’s a loner. Never has any friends over, just works at the bakery all the time and then locks himself inside the apartment when he comes home. He’s always trying to date Miss Sally but she don’t want nothing to do with him, he’s not good enough for her if you ask me.

58


Granny Smith: Well I always knew she would come to no good, that one! Living alone is no place for a young lady. I’m an old woman, no one cares if I live alone. But she was well liked around here, by everyone. Especially that Joe next door. What a nice man! And a hard worker too! He tried to date Miss Sally a few times, but she said no. Joe never gave up though, he just kept being sweet as pie, and said that one day she’ll see him for what he really was. I guess they’ll never see how perfect they would’ve been for each other now. Too bad. I bet Joe will be devastated when he gets home. I didn’t see or hear anything unusual, but I can’t see or hear very well anymore. I did hear some commotion this morning when the Landlord was banging around before the police came, but by that time it was already too late. I talked to her last night – she was looking for her house keys and asked if I had seen them. When I heard all that noise I got up and looked out the window. It was only the Landlord shoveling snow, and then I saw Joe come out of his apartment and leave for work. I don’t know why she would’ve left that window open with all the snow we got last night, not to mention the blowing wind, that was crazy!

Notes:

______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ 59


Joe: I still can’t believe she’s dead. I just saw her last night. Sure, she turned me down for a date a few times, but I wasn’t mad about it, plus she told me last night she’d go out with me this weekend. The landlord heard her say it – I don’t know why he’s trying to blame me for stuff. I just went to bed early last night like I normally do. I work down at the bakery at the end of the alley and I have to get up at 3:15AM to get the bread and donuts started at the bakery. Bakers always go to work in the middle of the night. Typically I leave around 3:30AM, after I have some coffee. I’m usually pretty good about getting to work on time, but I was a little late this morning. That could happen to anyone though, it don’t mean I murdered someone. I didn’t see any open window at her place and her light was off when I walked through the parking lot. Nothing unusual. The snow was just getting started and the wind was kicking up and the Landlord was already outside shoveling snow and throwing down the magnesium chloride. Looks like we only got a couple of inches, but it was very cold when I left for work around 3:45AM. I don’t see any practical reason why she would open that window; she was a fanatic about locking all her windows and doors. She even had a deadbolt put on the front door. I couldn’t have been more surprised when I came home at noon and Granny Smith came over to tell me what happened. I almost fell over, it’s all very sad. We could have really hit it off this weekend and had our whole lives ahead of us.

Notes:

______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ 60


Map of the Sunnyside Apartments

61


62


Unit Five – Documentation of the Crime Scene, Evidence, and Witnesses

63


64


Unit Five – Documentation of the Crime Scene, Evidence, and Witnesses The first responders and the initial assessment and documentation of the crime scene will set the stage for everything to come. Mistakes made at this juncture can greatly influence whether or not the guilty party, if found, is brought to justice, or slips free on a technicality. You were presented with a general list of procedures detailing crime scene investigation in Unit Two. In this unit we will concentrate on the specific actions required for documenting the crime scene, collecting and documenting evidence, and interviewing the witnesses. All of the above mentioned acts should be carried out methodically and with purpose. The first responders should have set up a boundary of the crime scene before investigators arrive. If evidence is obvious to them, markers should be placed nearby to prevent destruction of the object or observation. The investigator should determine where the point of entry to the crime scene took place as well as the point of exit. The point of entry is where the suspect gained access to a building, car, or a residence. It might be a window, a door, or a heating duct. It is important that the point of entry be secured so important evidence such as clothing fibers, fingerprints, or hair samples can be preserved. The point of exit may or may not be the same as the point of entry, but again it is important to secure the area to avoid contamination of potential evidence. 65


The first responder should brief the investigator of any knowledge gained since arriving on the scene. It is very important that nothing in the crime scene be disturbed until there has been a thorough documentation with a video camera and photographs. The documentation begins with the first responder interview. Once that information has been obtained the videographer should enter the scene and proceed to slowly and methodically record the area or rooms involved from every angle. This ensures that the crime scene can be reconstructed at a later date and used to formulate theories. Evidence should also be videotaped if present. After the video is made the scene should be photographed. Evidence should be photographed in close up detail just as it was when discovered. After the photographs a sketch or map will also be made. Everything at the crime scene should be documented for further evaluation. The documentation contains several basic parts: • Summary • Scene • Processing • Evidence collected • Pending The summary contains no opinions about the crime or the scene at hand. It is merely stated facts of the situation. It might read something like this: “At the request of dispatch, this writer was asked to respond to a hit and run accident involving a light blue Chevy truck and a yellow Toyota at the intersection of Main Street and Center Avenue. The driver of the Chevy tuck fled the scene on foot. The driver of the Toyota called 911 for assistance. Upon arrival a request for emergency medical services was made.” 66


The scene is a description of the area upon arrival. For example: “The door of the Chevy truck was ajar, the radio was still on, and the engine running. There was a brown wallet on the seat, an opened coke can in the drink holder, and the windshield was cracked and had blood on it. There was blood on the steering wheel.” In the scene all evidence that can be identified at the time should be notes, the weather conditions, and any other detail that might help in fitting the pieces of the crime together. Processing is used to describe the actions of the officers and investigators while on scene. The Evidence collection portion of the crime scene investigation will detail how the evidence was collected, who did the collection, where it was taken and for what purpose. Every jurisdiction can perform these steps a little differently and bigger cities might have specialized personnel who will come out to the crime scene especially for collection and documentation purposes. Physical Evidence is important because it can: • Prove that a crime has been committed • Establish any key elements of a crime • Link a suspect with a scene or a victim • Establish the identity of a victim or suspect • Corroborate verbal witness testimony • Exonerate the innocent Some evidence will require careful preservation techniques such as proper temperature. This must all be documented in the report. Trace evidence, such as hair strands, clothing fibers, and the contents of a vacuum bag will also be recovered and documented. Each type of evidence will then be sent to its proper place to be analyzed. Hair and blood will go to the DNA lab - fibers, soil, paint 67


chips, and glass will go to trace evidence lab - and illegal drugs and unknown substances will go to the chemistry or toxicology lab. If a crime scene is also a vehicle, it must be towed to a secure location. If the crime scene is a house the doors must be sealed. If the crime scene is an outside area crime tape is used to rope off the boundaries. Witness statements are not considered part of the physical evidence collection. Typically the investigators will interview witnesses and document what they say. The witness will also be asked to make a written statement. Credibility of witnesses is always a concern. Your jury will not pay much attention to a drunk homeless person who was half asleep when he witnessed something, but they will give more credence to an upstanding housewife who saw something while looking out her window as she did the dishes. Still, all witness statements must be taken and each one is but a single piece to the puzzle. Sometimes they will fit together and make sense, other times they will be inconsequential. Like other clues, that information cannot often be determined immediately and more clues must be found before accepting or discarding a witness statement as fact. The following are often used as physical evidence at a crime scene: • Fingerprints • Bite Marks on skin or other objects (a pencil maybe?) • Broken Fingernails from a struggle • Documents that may have a handwriting sample • Blood and Body Fluids • Firearms and Toolmarks (marks deemed to be made by certain tools) • Shoeprints and Tire Tracks can be on hard surfaces or soft surfaces. Pictures should be taken of hard surface marks and 68


•

• • • • • • • •

impressions or castings should be taken on soft surfaces such as dirt or mud. Fracture Matches (such as paper torn from a book and the bits left inside the book. These two “fractures” can be “matched up” and provide a reasonable conclusion that one belongs with the other. Hair Fibers from clothes or any other material such as rope Paint from a car that may indicate a collision Glass from breaking and entering or from a car headlight in a crash Pills or medications used for poisoning, overdose, or drug interactions Illegal drugs and paraphernalia used with these drugs Alcohol bottles and their contents Other Trace Evidence which could be connected to the crime in any way

Background investigations should also be performed on all witnesses and suspects to try and find any previously unknown connections which could lead to more clues.

69


70


Exercises for Unit Five Vocabulary

Define the following terms and phrases: 1. Methodically -

2. Point of Entry -

3. Point of Exit –

4. Trace Evidence –

5. Fracture Matches –

6. Physical Evidence –

71

Simple Schooling Forensic Science ©2010 7. Crime Scene Witness –

8. Fibers –

9. Credibility –

10. Exonerate -

Short Answer

Write a brief answer to each question

How can trace evidence be used to help solve a crime?

72

Simple Schooling Forensic Science ©2010 Name a few different kinds of trace evidence and state where these bits and pieces might originate from if you found them while searching the crime scene.

What is credibility and why is it important when questioning witnesses and then using their information to fit clues together?

Why is the boundary around the crime scene important?

Name several mistakes that first responders and investigators could make when processing the crime scene and collecting evidence.

73


Crime Scene Summary for Miss Sally’s Murder at Sunnyside Apartments Summary:

Upon arrival this officer approached the Sunnyside apartments from the parking lot alley and noticed that the window of the northwest apartment, the one later discovered to belong to the deceased, was open. There were no foot prints beneath the window even though 3 inches of snow fell overnight and the temperature was still at 5 degrees at 6:15 AM. Upon entering the courtyard form the parking lot alley, this officer noticed that magnesium chloride had been used to melt the snow and ice and the sidewalk slush was slightly tinted blue. The Landlord came out of his apartment and led me to Miss Sally’s door, which was ajar, and I proceeded to enter the apartment. I stopped at the front door after noticing a puddle of water, presumably from the Landlord’s boots when he entered the apartment earlier. A marker was placed and a picture was taken. No lights were turned on inside and the apartment was determined to be 17 degrees F using a Kestrel Portable Weather Station. An assessment was made and the open window was determined to be the open window. The deceased was lying on the couch. On the coffee table was a can of Diet Pepsi and a half eaten powdered donut. Some white powder was on the coffee table next to the plate. Investigators arrived at 6:45 AM, were briefed, and then the crime scene was video-taped and photographed. Evidence was collected by individual departments, each one approaching the scene one at a time to avoid contamination. Each piece was sent to the appropriate investigative facility after being logged and properly stored. Witnesses were interviewed and statements were taken.

74


Evidence Report for Miss Sally’s Murder at Sunnyside Apartments All evidence was collected according to all department policies and procedure and in such a way as to minimize contamination of the crime scene. Each item was logged in, tracked, and stored using proper conditions. Evidence list: Video of crime scene Photograph of clear liquid in front of front door Sample of clear liquid on floor in front of the front door Photo of open window, both inside and outside Photo of ground in front of open window (outside) Smudged Fingerprint photograph from bedroom light switch Smudged fingerprint from front door Half eaten powdered donut White bakery bag House keys Sample of white powder residue from coffee table Photograph of window locks Photograph of front door lock Magnesium chloride tinted snow from courtyard

Notes: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ 75


Notes: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ 76


Unit Six - Forensic Ballistics: The Science of Guns and Toolmarks

77


78


Unit Six – Forensic Ballistics: The Science of Guns and Toolmarks What is forensic ballistics? Forensic ballistics is the science of analyzing firearms used in crimes and includes: • Analyzing bullets and shell casings to determine what type of gun it came from • Analyzing bullet impacts • Analyzing Toolmarks or unique identifying markings which tie a bullet to a firearm Ballistics is the science of analyzing the flight path of a projectile as it moves through space. The flight path includes: • • • •

Travel of the bullet inside the gun (down the barrel) Travel of the bullet as it leaves the barrel and enters space Travel of the bullet through space Travel of the bullet through the target

Firearms and toolmark identification is the science of determining from which gun a bullet originated from and includes the analysis of: • The firearm • The ammunition • The toolmark evidence All of these things together are used to make a conclusive determination that a firearm was or was not used in a particular crime. A toolmark is a unique identifying mark which is produced by a tool. A tool can be any tool – a screwdriver, a hammer, a gun. A toolmark would 79


be the scratches made by the screwdriver as it was used to pry open a window, the impact impression of a hammer on wood, and the scratches carved in a bullet as it is released from the gun barrel. Specifically, firearms identification uses all of the above techniques to conclusively establish that a certain gun fired a certain bullet. This certainty is based on the fact that all firearms will produce unique identifiers (marks) on the bullet which will match up with the tool, (the gun barrel and projectile mechanism inside the gun) because the tool, or gun, is made up of harder components than the bullet. Therefore, the harder component, the gun, will engrave markings onto the softer component, the bullet, which can later be perfectly matched up in an analytical setting. Just like a fingerprint, no two firearms will produce the exact same toolmark. In addition, rifling – or the act of creating “spin” on a projected bullet by carving a helix pattern inside the barrel, will increase the accuracy and rage of the fired bullet.

Rifling pattern on the inside of a barrel

Rifling patterns are unique to the manufacturer of the gun and will further enable the forensic experts to conclude which gun did the firing.

80


This bullet clearly shows the unique helix rifling pattern

Big take home picture: toolmark identification enables investigators to conclusively match up a bullet with the gun it was fired from. Ballistics will determine the flight path of the bullet and will add or detract from a current theory of who shot a gun and from which vantage point. The formulas used to make ballistics determinations are far beyond the scope of this course but will use applied physics to account for trajectory. Trajectory Elements The trajectory is the path a moving object follows through space. The path of a trajectory can be classified into three groups: • Intrinsic – all trajectory share these elements • Initial – elements that describe conditions at the origin • Terminal – elements that describe conditions at the point of impact

81


Each element, as it takes into consideration all forces that can act on the bullet, becomes increasingly complex as shown by the diagrams below:

82


Firearms and ballistics evidence submitted to a forensic lab for investigation will include: • The firearm(s) in question • Bullets used/recovered from the crime scene • Spent cartridge cases recovered from the crime scene • Spent shot shells and/or shot (See picture below) • Shot shell wadding (See picture below) • Live unspent ammunition • Clothing that might have gun powder residue on it

Anatomy of a shotgun shell

83


84


Exercises for Unit Six Vocabulary

Define the following terms and phrases: 1. Forensic Ballistics -

2. Ballistics -

3. Toolmarks –

4. Trajectory –

5. Rifling –

85


6. Shot (from shotgun shells) –


Give 3 examples of toolmarks.

When looking at intrinsic elements of trajectory, give an example of the origin and the point of impact.

86


What does initial trajectory describe?

What does terminal trajectory describe?

Research and Critical Thinking Use the following sites to answer the questions http://www.youtube.com/watch?v=jjUTZH_Vdxs

Watch the video above. What kind of trajectory element does this video show?

87

Simple Schooling Forensic Science ©2010 http://www.youtube.com/watch?v=2-rHJnuXilg&feature=related

Watch the video above. The name of the video is “Hollow Point Bullet Through Gelatin in Super Slow-Mo” What is different about the terminal trajectory of this bullet?

http://www.youtube.com/watch?v=CBAS050qo20&feature=related

Watch the video above. What are the helix marks on the side of the bullet?

Go to the following website:

http://jersey.uoregon.edu/vlab/Cannon/

This is a ballistics simulation using a cannon. You can adjust muzzle velocity, gravitational potential, angle of the cannon, wind drag, and density of the cannon. Try your hand at adjusting the variables and see how many shots it takes you to blow up the target. It took me 6. They only give you four shots, so you have to “re-load” if you use more. How many shots did it take?

What were your settings?

88


What was the most important variable?

Adjust the gravity to -19.6. What happens to your cannon balls? Why?

Go to: http://science.howstuffworks.com/gun-roundup.htm Read two articles that interest you and then give a brief summary of what they were about. The toolmark and ballistics team looked at the scene of Miss Sally’s death and determined that no one broke in through the window to enter the apartment because there were no paint chips present nor were there any indentations make by a tool such as a screwdriver or crowbar. The killer entered the apartment through the front door

89


90


Unit Seven – Fingerprints

91


92


Unit Seven – Fingerprints Just about everyone knows that fingerprints are consistently used as unique identifying markers for solving crimes. That is because fingerprints are one of a few characteristics that will not change over time. In the next unit we will look at DNA, but relatively speaking, DNA technology is a new science. Fingerprints were the big guns of crime detection for over a hundred years before newer methods took over. How it all started: In 1880 Dr. Henry Faulds, the British Surgeon-Superintendent of Tsukiji Hospital in Tokyo, Japan, published a paper in the scientific journal Nature. In his paper he is the first to state that fingerprints can be used as unique identifiers and he also discussed the use of ink as a means of recording fingerprints. The world of crime detection would never be the same!

Fingerprints are the result of minute ridges and valleys found on the hand of every person. In the fingers and thumbs, these ridges form patterns of loops, whorls and arches. 93


Each of the three pattern types have focal points which are used for classification. In the Loop pattern there are two focal points: the Core, or the center of the loop, and the delta. The Delta is the area of the pattern where there is a triangulation or a dividing of the ridges. When recording fingerprints, the delta and the area between the delta and the core must be completely recorded.

A Whorl pattern will have two or more deltas. For a whorl pattern, all deltas and the areas between them must be recorded.

94


The Arch pattern has no delta or core; but, it too, must be fully recorded so that its individual characteristics can be readily distinguished.

An impression the taking of fingerprints using ink or a digital media. These impressions are recorded on a card or computer. The card will have several rows and looks like this:

95


There are two types of impressions involved in taking fingerprints. • Rolled – the finger tip is rolled as it is recorded and each finger is done separately • Slapped – all fingers are done simultaneously and there is no rolling of the fingers For rolled prints the upper ten impressions are taken of each individual finger, described below: • Thumb • Index • Middle • Ring • Little These impressions are rolled from one side of the fingernail to the other, in order to obtain all available ridge detail.

The impressions at the bottom of the card are taken with all of the fingers of each hand at a forty-five degree angle and then the thumbs. The plain impressions are used to verify the sequence and accuracy of the rolled impressions. Latent prints are fingerprints that can be found on any surface and can either be made by the natural secretions of the hand, or by a substance like ink, blood, or even motor oil. 96


Patent prints are visible by the naked eye and do not need to be lifted like a latent print. These are simply photographed. Plastic prints are fingerprints made in a material that will hold the shape of the print. This occurs on surfaces like putty and melted candle wax. It is important to remember that when you lift a latent print off an object from a crime scene, you will almost never get a perfect print like the ones shown in the pictures above. Fingerprint evidence that can convince the judge and jury is the main objective of investigators, so it is important that you follow all procedures. These days fingerprint specialists will arrive at the crime scene, use a fine powder to dust over any latent prints, and lift those prints off the object with tape and place them on a card for future identification. Later, at the fingerprint lab, they are entered into the central FBI database called the Integrated Automated Fingerprint Identification System or IAFIS. When the prints are entered into the system they can be compared to over 55 million records on file while the suspect is still in custody. Prior to 1999 fingerprint checks could take up to 3 months to perform because the work was labor intensive.

97


98


Exercises for Unit Seven Vocabulary

Define the following terms and phrases: 1. Loop -

2. Core -

3. Delta –

4. Whorl –

5. Arch –

6. Latent fingerprints –

99

Simple Schooling Forensic Science ©2010 7. Patent fingerprints –

8. Plastic fingerprints -

Short Answer

Write a brief answer to each question

What is the IAFIS used for?

Describe the differences between slapped fingerprints and rolled fingerprints.

100


Research and Critical Thinking Use the following sites to answer the questions http://www.topspysecrets.com/fingerprint-powder.html

Make the fingerprint powder and then follow the directions on making one of your fingerprints visible. Put your print below. What kind of fingerprint pattern does your fingerprint have? Identify at least 2 landmarks that prove your pattern is what you say it is.

http://www.youtube.com/watch?v=ZZHf5G8MuUw

How do crime scene photographers photograph a crime scene?

101

Simple Schooling Forensic Science ©2010 http://www.youtube.com/watch?v=HIck-I-S8r8&feature=related

What is MXRF?

How does it work?

What problems does it solve?

Fingerprints have been used as identifying markers in crime scenes for over a hundred years. Name several pros and cons of this method of crime detection.

Pros: 1. _________________________________________________ _________________________________________________ _________________________________________________ 2. _________________________________________________ _________________________________________________ _________________________________________________ 3. _________________________________________________ _________________________________________________ _________________________________________________

102


Cons: 1. _________________________________________________ _________________________________________________ _________________________________________________ 2. _________________________________________________ _________________________________________________ _________________________________________________ 3. _________________________________________________ _________________________________________________ _________________________________________________

The fingerprints found at the scene of Miss Sally’s death could not be matched because not all identifiable markings were present. Fingerprint analysis for this crime - inconclusive

103


104


Unit Eight – Introduction to DNA

105


106


Unit Eight – Introduction to DNA DNA is the abbreviation for deoxyribonucleic acid. DNA is one of the basic “building blocks” of life and is present in all living organisms. DNA is an even more unique identifier than fingerprints and is contained inside every living cell in the body. A person's DNA is the same in every cell that has a nucleus. Almost all cells have a nucleus, red blood cells do not. So red blood cells do not have DNA. Blood, however can still be tested for DNA because there are other components in it which do have nucleated cells. The DNA in a person's blood is the same as the DNA in their skin cells, semen, and saliva. DNA is comprised of four building blocks called bases. The building blocks are: • Cytosine • Guanine • Thymine • Adenine These are commonly referred to as C, G, T, A. The bases line up along the DNA backbone which is a long chain of sugar and phosphate molecules. The order that the bases lineup is important because that is what makes every individual unique. Each molecule of DNA actually has two strands of sugar phosphate molecules and they twine together to form a helix structure due to the attractive forces of the bases. Each base on one strand will pair with another base on the opposite strand to form the “ladder” in between the backbones. 107


There are rules in biochemistry though, and these rules state that the bases can only pair with their “partners”. It just so happens that C and G are partners and A and T are partners. So if you have an A on one strand, the opposite strand MUST have a T paired with it.

When solving crimes, a forensic DNA laboratory will use the evidence samples collected from the crime scene and run tests on them to extract out the DNA. Then the DNA is amplified (copied over and over again so that a little itty bitty amount turns into lots of DNA) and a tests are run to make the DNA pattern that can be used to compare against a suspect. Most often a test is run that uses a feature of DNA called short tandem repeats (STR). If you were to compare the DNA of any two 108


random humans, most of it is identical. Only certain non-coding parts (These areas of DNA used to be called “Junk” DNA because we thought they served no purpose) will vary enough from person to person to be unique identifiers. These short tandem repeats are the areas that forensic scientists use to establish identity, which can then either exonerate the innocent or help place a suspect at the scene of the crime or to a particular weapon. Line of DNA Code Showing the Repeat Bases Used for Identification TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACAGGTGG ATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA TCATTGAAAGACAAAACAGAGATGGATGATAGATACATGCTTACAGAT GCACAC The Blue Bases are the Short Tandem Repeats (STR's) There are several different patterns that are acceptable for forensic testing. Name of Pattern • Dinucleotide (2) • Trinucleotide (3) • Tetranucleotide (4) • Pentanucleotide (5) • Hexanucleotide (6)

Example of Repeat Pattern (CA)(CA)(CA)(CA) (GCC)(GCC)(GCC) (AATG)(AATG)(AATG) (AGAAA)(AGAAA) (AGTACA)(AGTACA)

The Standard in the US for forensic identification to hold up in court, if for 13 specific areas on a person’s DNA to be sampled. Every STR test is run using the same pieces of DNA, called Loci. If a match is made between the sample from a crime scene and a suspects 109


DNA, then the scientists cite the statistical probability that another person could have the same matching DNA. Typically there are three possible laboratory outcomes: • If the DNA profiles from the evidence samples and suspect samples are the same at each locus (each of the 13 sections of DNA that must be tested), laboratory analysts can interpret this finding as a "match", "inclusion", or "failure to exclude." (Basically – yes, this belongs to them) • If the two samples are not consistent at each locus, the finding can be interpreted as a "non-match" or "exclusion." (basically – nope, this evidence does not belong to them) • If there are insufficient data to support a conclusion, the finding is often referred to as "inconclusive." (Maybe the sample was contaminated) The same principles can be used to establish a relationship between two or more people, such as the identity of a person’s remains that were badly burned or that have decomposed so much that no identifiable features are recognizable.

It is especially important to maintain crime scene integrity when using DNA as evidence. Very small amounts of contamination could render the sample useless. 110


In addition, all procedures for the collection, handling, and storage of the DNA samples should be followed exactly. Because DNA samples can some from very small, or trace, amounts, you will often not be able to see the evidence at all. In this case a cotton swab of the area can be performed and then the sample can be analyzed at the lab to see if any DNA can be extracted. As with all crime scene evidence, chain of custody documentation is important! Remember, you cannot convince a jury that this sample is indeed the one taken from the crime scene, if you cannot produce a record of every single person who came into contact with that piece of evidence. DNA evidence is really not that fragile. Samples can maintain their integrity for decades, even centuries! However, some common sense precautions should be taken. Keep out of direct sunlight and store in a cooled environment if possible. Samples generally considered unsuitable for testing with current techniques include embalmed bodies (with the possible exception of bone or plucked hairs), pathology or fetal tissue samples that have been immersed in formaldehyde or formalin, and urine stains. Want to learn more? Take a free online training course from the FBI at http://www.dna.gov/training/ Don’t be afraid of the courses, even if they appear very difficult. You don’t have to understand everything to gain additional knowledge!

111


112


Exercises for Unit Eight Look at the chart below – follow the directions for coloring the back bone and bases.

113


114


What are some of the limitations of using DNA to identify suspects? Go to

http://www.ornl.gov/sci/techresources/Human_Genome/elsi/forensics.shtml and

choose a case study under the topic “Some Interesting Uses of DNA Forensic Identification”

Write a short summary about how DNA was used to solve a case or identify people. _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ _____________________________________________________ \ 115


Build a DNA model using candy Supplies – 10 Toothpicks 2 strands of red licorice 20 Gumdrops or Dots 4 different colors – 5 of each color 1. Separate your gumdrops into piles, one pile for each color Choose one color and call it adenine Choose one color and call it guanine Choose one color and call it cytosine Choose one color and call it thymine 2. Pair up your bases – which bases are partners? A pairs with ________ G pairs with ________ 3. Spear your “paired” bases into each end of one tooth pick. 4. Repeat until all candy pieces are used up. 5. You should have 10 toothpicks with gumdrop pairs. 6. Poke each tooth pick in between the two strands of red licorice to complete your DNA model.

116


It should look like this when it is done:

117


Draw a diagram of your DNA model and color the “bases” the correct color. Label each base along the ladder like this:

When you line the first letters of each base up horizontally you get what we call a “sequence”.

118


119


120


Unit Nine – Arson and Explosion Investigations

121


122


Unit Nine – Arson and Explosion Investigations Arson is defined as the deliberate act of setting fire to a structure or wildlife area. Sometimes arson is done to illegally collect on home insurance. There are several departments and investigators who take part in a fire investigation such as: Fire Department – The fire department has control of the fire scene until such time as the fire is completely put out. They may or may not be part of the actual fire investigation but will be expected to contribute to a criminal case if necessary. Fire Marshal – The duty of the fire marshal varies according to location but often they serve the public by enforcing building codes and fire investigations. They are usually experienced firefighters. Arson Investigator – Investigates origins and causes of fires and assists in the legal prosecution of arson cases. May or may not be a law enforcement professional. There are also private arson investigators who may be hired to perform an investigation. Insurance Investigator – A private arson investigator who’s responsibility is to determine if the fire was caused through natural or unnatural reasons. They represent the insurance company. Unlike the fire marshal and the public arson investigator, the insurance investigator is not certified by the state. Instead they are certified by a private entity. An arson investigation starts with the fire itself. Every fire must have a source of fuel, heat, and oxygen.

123


In a naturally occurring fire none of the above will have been tampered with. However, in an arson case, there is any number of ways to manipulate these three factors to create a fire. That is what arson investigators are looking for when they conduct their investigation. An arsonist may tamper with the fuel by introducing flammable material such as bedding, curtains, or clothing. Or they may add flammable accelerants such as kerosene, gasoline or alcohol, either by themselves, or in combination with a flammable material, such as gasoline soaked rags. They may also increase the oxygen content of a structure by opening windows or punching holes in ceilings and walls. Fire will follow the highest concentration of oxygen to its source. By ventilating a structure at the top and starting a fire at the bottom of the structure, an arsonist can cause the fire to race upward. The fire will rapidly involve the whole structure rather than be confined to one room, creating considerably more damage in a shorter period of time. A heat source can be a simple match or lighter, or a complex mixture of chemicals. All arson fires involve the introduction of a heat source. A fire will not be considered an arson fire unless all other accidental reasons have been ruled out. In order to positively say that a fire was deliberately set, one of the three factors above must be proven to have been tampered with. The Arson Investigation An Arson investigation will start with the firefighters who were present at the scene. They are often experienced enough to know when something about the fire is “off” and can alert investigators to an area that should be looked at further. 124


These observations may include such things as: • Multiple points of origin (The fire started in more than one place) • Presence of flammable accelerants such as gasoline or kerosene Normally in a criminal investigation the witness interviews are not done immediately, but after the physical evidence of the crime scene has been processed. In a fire investigation the firefighters and witnesses are interviewed immediately. They will want the answers to many of the following questions: • What color was the smoke? The color of smoke can sometimes indicate what was burning. o Gasoline produces a yellow or white flame with black smoke Wood produces a yellow or red flame and grey or brown smoke. If a burning wooden house is producing thick black smoke this could indicate the presence of gasoline. A large amount of gasoline being stored in a house is unusual and raises the suspicion that gasoline was used as an accelerant • Did they notice fire systems such as sprinklers? • Were there any signs of forced entry? • Were the burning items present in the structure normal everyday items or was the structure empty of these items? o An absence of normal items could indicate that the structure was emptied before the fire was started, indicating arson as a strong possibility. Witnesses will then be questioned about what they saw, if they noticed anything unusual, saw anyone entering or exiting the structure, or knew of any other information that might contribute to the investigation. Physical evidence is an important part of a fire investigation and often a faulty gas or electrical equipment is to blame for naturally occurring fires. 125


If an accelerant was used by pouring over carpet, the floor below the carpet will have a distinct and characteristic pattern that can be removed and sent to the lab for analysis. Explosion Investigations Contrary to intuition, bombs do not make evidence disappear and forensic scientists who specialize in explosives can send minute fragments to the lab for analysis and determine many useful pieces of information. Bomb investigations will closely resemble fire and arson investigations. They will both have: • A high safety priority, • Will involve a physical change in materials like the conversion of solid or liquid into gas, and/or the conversion of small quantities of matter into energy. • Involve a chemical change or reaction which causes a rearrangement of atoms. • Must take place in the presence of oxygen Bomb investigators must be very well educated in chemistry and physics in order to accurately determine the reactions that took place, as well as the mechanics of the explosion. Some of the most common explosive devices seen are homemade pipe bombs which use nothing more than black powder from shotgun shells and a metal pipe. Much more complex are explosives using TNT (trinitoluene) or nitroglycerin. Nitroglycerin is found in dynamite, which combines sodium nitrate, nitroglycerin, and other non-explosive, or inert, compounds. One type of explosive is ammonium nitrate, used in the 1993 World Trade Center bombing and the 1995 Oklahoma City bombing. Combined with fuel oil, it is known as ANFO, a foul-smelling— and lethal—sludge. 126


Simple pipe bombs do not require a detonator device or timer, but the more sophisticated types of explosives to. This timer or detonator can be very complex, or very simple. Forensic investigators familiar with explosives will be able to find very small remnants of the bomb and be able to reconstruct the components using very sophisticated equipment. If you have ever taken physics you might remember the first law of thermodynamics which states: Energy can neither be created nor destroyed. That means that there will ALWAYS be evidence of explosions, even though it might be invisible to the naked eye.

127


128


Exercises for Unit Nine

Candle Experiments by Michael Faraday

Anatomy of a candle flame

The exercises for Unit Nine are to perform the candle experiments first proposed by Michael Faraday in 1859. He used to tell children three “stories” relating to the physics and chemistry of fire. After his story he would demonstrate everything he said using a candle and some household materials. You will be repeating some Faraday’s experiments here.

129


Supplies: lighter a small candle aluminum foil ice cubes metal jar lid a small bowl small drinking glass or glass jar You already know that in order to have fire three things are involved: Heat, fuel, and oxygen. If you are missing any one of these things, the fire will go out. Experiment 1 Light a candle and let it burn for about one minute. Have a lighted match or lighter ready. Carefully blow out the candle. Watch the smoke trail coming up from the extinguished candle and quickly place your lit lighter into that smoke stream. What happened to the candle? Why? Experiment 2 With a few drops of hot wax fix your candle to the center of a bowl. Pour water into the bowl so that it is partially filled. Light the candle. Place an empty jar or glass over the candle so that the edge is under the water line. 130


What happens to the candle? Why? Experiment 3 Mold and cut a square of aluminum foil into the shape shown below:

Place the foil between the candle and flame so that the wick goes through the slit in the foil. Narrow the slit and slide it up towards the very tip of the wick. What happens to the flame? Why?

Read the following webpage about The Yellowstone Fires: http://www.yellowstone-bearman.com/yfire.html How did the 1988 Yellowstone fire affect the weather?

Why did the prevention of forest fires contribute to the uncontrollable Yellowstone fire?

What should they have done to prevent a huge catastrophic fire?

131


132


Unit Ten – Trace Evidence

133


134


Unit Ten – Trace Evidence Trace evidence refers to materials or substances that are generally small in size and can be transferred when physical contact occurs between: • Two individuals • An individual and an object • Two objects Types of evidence included in this category are: • Hairs • Textile fibers • Soil • Glass particles • Paint chips • Feather fragments • Chemical residues (from explosives) Many criminals are discovered and successfully prosecuted after trace evidence connects them with the victim or crime scene. An example of this would be when hairs from a missing person are found on the person of or in the home of, a suspected criminal who had no previous relation with the victim. Hairs can potentially be subjected to DNA analysis and a positive match made. Another more common approach to hair analysis is the light microscope. Hairs from certain regions of the body have specific characteristics. For example, a hair from your head would not have the same microscopic characteristic as a hair from your arm. In addition, human and animals hairs can be differentiated. The most common tool for this type of analysis is the comparison microscope. A comparison microscope is really just two compound light microscopes connected by 135


an optical bridge that allows for the simultaneous viewing of questioned hairs and known hairs. Typically, a glass microscope slide containing known or reference hairs is positioned on the stage of one microscope, and a glass microscope slide containing a questioned hair or hairs is positioned on the stage of the other microscope. This enables the hair examiner to compare the microscopic characteristics of the known and questioned hairs in one field.

A comparison microscope showing two matching hairs in the same field of vision

Although this type of analysis is helpful, it is not perfect. It cannot accurately predict, like DNA evidence can, that a hair belongs to a specific person or animal. I can however, tell if a hair was shed naturally or forcibly pulled from the head.

Naturally shed hair

Forcibly pulled

136

Forcibly pulled with skin still connected


Textile Fibers A fiber is the smallest unit of a textile and can be naturally occurring or manmade. Fibers can be transferred in the following ways: • From the clothing of a suspect to the clothing of a victim when a crime is in process • From a fabric source such as a carpet, bed, or furniture at a crime scene There are two types of fiber transfers: Primary or direct - when a fiber is transferred from a fabric directly onto a victim's clothing Secondary or indirect – when the primary transfer then transfers a second time to either a victim or other piece of evidence It is important to understand the science involved in these transfers in order to draw accurate conclusions about how and why it happened. There are many different types of fibers and each one will carry with it its own set of unique characteristics. For example, natural fibers such as cotton, wool, and flax will each appear different under the light microscope.

Cotton fibers under the light microscope

137


Flax Fibers

Wool Fibers

You might not be able to see the differences immediately, but to a trained scientist, the characteristics that make each of these fibers unique are readily apparent.

Carpet fibers, cut in cross section, and seen under a scanning electron microscope (SEM)

When fibers are matched with a specific source (fabric from the victim, suspect, and/or scene), a value is placed on that association. This value is dependent on: • Type of fiber found • Color or variation of color in the fiber • Number of fibers found • Location of fibers at the crime scene or on the victim • Number of different fibers at the crime scene or on the victim that match the clothing of the suspect 138


The type of physical contact between a suspect and a victim can determine the number of fibers transferred and the value placed on their discovery. Value is a term used to describe how important these fibers are to the case. Violent physical contact of an extended duration will very often result in numerous fiber transfers. Paint and Glass Evidence Most paint evidence that is submitted to a crime lab will come from cars involved in a hit and run accident. Typically glass from headlights or windows will also be evidence in a hit and run accident. Paint matches are made using an FBI database called the National Automotive Paint File. Using this database paint chips from cars can be compared to samples in the database. A similar database, called the Glass Evidence Reference Database, is used to identify glass fragments. It contains over almost a thousand samples taken from manufacturers, junkyards, and distributors. This database cannot determine the source of the glass, but it can give statistical data that determines the likelihood that tow samples taken from different sources would have the same elemental profile.

139


140


Exercises for Unit Ten

Answer the following questions: What is trace evidence?

How are pieces of trace evidence transferred?

How is hair analyzed?

141


Name one thing the light microscope can tell that DNA analysis cannot.

Name one thing that DNA analysis can tell but the light microscope cannot.

What is a fiber?

What are the two types of fiber transfers? Describe each one.

142


Name one way in which numerous fiber transfers might occur.

Go to the following web page and answer the questions below. http://www.ojp.usdoj.gov/nij/journals/258/forensic-databases.html

Name the database used to trace each type of evidence below: Ballistics – Glass – Paint – Automotive paint – Shoe Prints – Handwriting – Ink – Flammable Liquids -

143

Simple Schooling Forensic Science ©2010 Rocky Mountain Trace Evidence Laboratory 1400 Main Street Rocky, CO Date - 01-15-2009 Case # - 11223 Patient – Sally Smith SAMPLE DESCRIPTION Hair sample 1 Hair sample 2 Hair sample 3 Hair sample 4 Hair sample 5 Hair sample 6 Hair sample 7 Hair sample 8

Age/Sex – 21/F VICTIM MATCH Positive Positive Positive Negative Negative Negative Negative Negative

DOB – 12-18-1988 CONCLUSION

SUSPECT MATCH

Belonged to Victim Belonged to Victim Belonged to Victim Unknown Unknown Unknown Unknown Unknown

Not applicable Not applicable Not applicable Joe Joe Landlord Landlord Landlord

All hair samples were removed from the victim’s clothing. No evidence of forcible removal was noted on any of the hairs. DNA suspect matching was done after obtaining control samples and voluntary consent from suspect Joe and suspect Landlord. Specimens were intact upon receipt. Chain of Custody, specimen security, and integrity has been maintained. Testing has been performed as requested by Rocky Colorado Police Department under their direction. All in-house analysis have been conducted by Rocky Mountain Trace Evidence Laboratory employees who have received special training and education in the procedures performed and are licensed in the state of Colorado as Trace Evidence Specialists.

Reviewed By:

Date: 01-16-2009

J. Anne Huss, Trace Evidence Specialist

144


Look at the trace evidence report above. It states that eight hair samples were removed from the victim’s clothing. Three samples belonged to the victim, two samples belonged to suspect Joe, and three samples belonged to suspect landlord. What sort of conclusions can you extrapolate from this evidence?

What other questions does this report raise?

What assumptions can be made with the arrival of this evidence?

145


146


Unit Eleven – Death, Investigation, and Certification

147


148


Unit Eleven – Death, Investigation, and Certification It might seem that death would be an easy thing to identify, but that is not always the case. There are in fact several “near-death” states that actually make determination a little more difficult. One of these states is brain death. As the knowledge base of medical science grew during the mid 20th century, it became apparent that death was not a cut a dry human condition. There could, for example, be a time when resuscitative techniques such as CPR could restore heart function but not brain function. This happens when the person had been “dead” for a period of time that exceeds 3 or 4 minutes so that the brain stem is no longer able to maintain any function. The brain stem is the part of the brain which controls basic life support functions such as breathing.

149


A persistent vegetative state is not the same thing as brain death. The vegetative state occurs when the cerebral cortex, the part of the brain that controls consciousness and intelligence, is no longer functioning. The brain stem, however, could be fine and so the person could continue to breathe and exist in a “living” state for years. Death then, is a condition where an individual experiences irreversible unconsciousness with complete loss of brain stem function. The heart can still be beating. The symptoms of brain death include: • Fixed and dilated pupils • Lack of eye movement • Absence of breathing reflexes • Unresponsiveness to painful stimuli These conditions should be backed up with evidence that the individual has experienced some kind of disease or injury which would cause brain death. A final determination of brain death must involve demonstration of the total lack of electrical activity in the brain by two electroencephalographs (EEGs) taken twelve to twenty-four hours apart. As medical science and technology improve, there is an increasing awareness that “death” was not a simple definable event, but rather a complex process. Cause of Death The “cause of death” can be defined as the diseases, conditions, or injuries which either resulted in or contributed to death and the circumstances of the accident or violence which produced such injuries.

150


It is important to note that there is a combination of things which contribute to the final cause of death and all of these things are listed on the death certificate in the order of importance.

An example of a death certificate listing the Cause of Death. Notice that the causes are actual medical conditions and not circumstances.

Manner of Death The manner of death was added to the US Standard Certificate of Death in 1910 in response to public health concerns. It is intended for statistical purposes only. There are only five manners of death: • Natural • Accident • Suicide • Homicide • Undetermined Most deaths are natural. The 5 manners of death have different The category of “undetermined” is used most frequently when there is insufficient evidence to establish whether a death was a suicide or an accident. Some systems use a sixth category such as “unclassified” but this is generally regarded as being an unnecessary complication. 151


Determining the manner of death requires that information which needs to come from a wide variety of places and sources. These include: • Reports of the circumstances of the death (what the person did and / or what happened to the person immediately prior to death), • The findings of the autopsy, toxicology, histology and other investigations and the medical history of the decedent. In most cases, simply knowing the circumstances of the death reveals the most useful information. It is almost always the case that the manner of death cannot be determined from the autopsy by itself and this fact stresses the importance of the death investigation conducted by the law enforcement agencies involved. The manner of death is not necessarily a definition of the legal consequences of a death. A fatality resulting from a vehicular “hit-andrun” incident should be classified as an accident, irrespective of whether criminal proceedings are subsequently initiated against the driver. If, however there is a clear intent expressed by the driver that he intended to kill the deceased with the car, then the manner of death is homicide. In addition, if there is clear intent that the deceased intended to walk out in front of a moving vehicle, then the manner of death would then be a suicide.

152


The Death Certificate The purpose of the death certificate is a legal one. It gives the date, cause, and location of death. In addition, if a legal investigation is in play, the death certificate can substantiate the manner of death.

153


154


Exercises for Unit Eleven In order to get more practice in crime scene investigation today’s exercises include a website that will allow you to work through another case study.

Go to the following link and look over the entire crime scene then come back here and answer the questions: http://www.virtualmuseum.ca/Exhibitions/Myst/en/game/index.phtml

Who were the two main suspects?

Why were they suspects?

155


Which suspect did you think committed the crime and why? Name all pertinent clues and how they related to your suspect.

Which suspect actually committed the crime?

Was your guess correct?

All crimes have twists and turns because the investigators can never know ALL of the information necessary when they make their predictions. Think of some of the clues in this course’s case study that are confusing and list them here:

156


Death Statistics Go to the following website and look at the chart which describes the statistics for the leading cause of death in the US for 2002. http://www.the-eggman.com/writings/death_stats.html

What is the leading cause of death among all age groups?

What is the leading cause of death among 15-24 year olds?

What is the leading cause of death for 55-64 year olds?

Can you think of some reasons why these statistics might be this way?

157


Look up the death statistics for your state and see if you can find similarities and differences when compared to those you just looked at. What is the leading cause of death for all ages? Your age group? If the causes are not the same explain why.

Similar Statistics

United States

Your State

158

Different Statistics


Unit Twelve – The Autopsy

159


160


Unit Twelve – The Autopsy The History An autopsy should not be carried without at least some information. The coroner or medical examiner’s office should have knowledge of the circumstances in which death occurred (or the body was found). These circumstances will include all important events and issues which may have contributed to the death including and natural diseases and treatments. This type of information can be elicited from the onlookers, witnesses, friends, and family of the deceased person, and the law enforcement agency in charge. The Scene of Death Unless the circumstances surrounding the death of the individual are immediately suspicious (like a knife sticking out of the body at an angle making it impossible for the deceased to have done alone) it is unlikely that the pathologist in charge of the autopsy will need to visit the scene of the death. If however, the investigating officers immediately suspect that homicide may be the manner of death, then the pathologist should, if at all possible, visit the scene prior to body removal, so a professional opinion can be formed from undisturbed surroundings of the body. The use of digital photography produces images of high quality which may be very informative to an experienced pathologist and would be taken in all cases for crime scene documentation purposes.

161


The autopsy is used to look at a single moment in time after a person has expired. When thinking critically about the autopsy the pathologist must always remember that the system they are looking at was once a dynamic and functional. The pathologist should look at the evidence and the body to determine the cause and manner of death. Autopsies have certain limitations which must always be considered such as: • It only reveals changes in the anatomical structures • Functional changes can only be seen if a structural change takes place in a specific organ or tissue The Autopsy Report The autopsy report is a formal documentary of biological evidence of the disease or injury which led to the cause of death of the individual and has infinite value to both investigators as well as family members. For example: • It can substantiate suspicions brought up by investigators • It can lead investigators away from a dead end investigation and towards the truth • It can give closure to family members looking for a reason why this happened Autopsy Protocol A well-constructed autopsy protocol is invaluable. It serves as a guide to the autopsy itself, a checklist to make sure that nothing is missed out and as a guarantee of uniform structure from one report to the next. It also provides a convenient way of understanding what goes on at an autopsy. This can be of particular importance in a court setting. The following list is a general protocol for the steps involved in an autopsy: 162


• Preliminary Procedures – such as date, time, and location of the autopsy • Summary of Known Circumstances – anything known about how the deceased died • Documents Reviewed And/or Evidence Examined – all pertinent evidence found at the scene or other places such as knife, bottle of pills etc. • External Examination of Body – such as the victim's clothing, and inventory of jewelry, valuables and evidence recovered; body weight and length; general condition of the body; description of the color and condition of head and body hair, examination of the nose and mouth to include dental examination; external condition of body areas, any puncture marks to include those of needles; and, specific injuries noted, such as stab wounds, gunshot wounds or blunt instrument injuries • Victim Identification Procedures – fingerprints, dental examination, x-rays if necessary • Internal Examination of Body – gross examination of body organs which includes the weight and notes of general structure. Organs typically examined are liver, pancreas, heart, and lungs. • General Description of Body Organs – this phase will include pathology, or microscopic examination, of sections of each of the organs. • Specific Description of Wounds or Injuries related to specific types of trauma – such as those inflicted by: o Handgun or rifle o Shotgun o Blunt force instrument o Fracture o Stabbing, cutting and penetrating instruments o Asphyxia, hanging, strangling or drowning 163


o Fire or burn, electrocution or lightning o Infant death, child abuse or Sudden Infant Death Syndrome o Record of Specimens Retained and Examinations Performed Histology Samples of individual organs are taken during the autopsy and after special preparation are examined using a light microscope. By examining these tissues microscopically, abnormalities can be seen which enables the pathologist to make a determination of death. Sometimes these changes can be seen without a microscope, but the great thing about histology is that it reveals diseases and conditions which were invisible without microscopic examination.

Normal heart cells and diseased cells in a person who died of an acute myocardial infarction (heart attack)

The image above shows normal heart tissue and heart tissue in a person who died of a heart attack. The important thing to note from this image is that there is a very obvious difference between the two cell types indicating that a morphological, or structural change in the tissue, has occurred. Toxicology Toxicology is the collection of various bodily fluids or tissues in order to determine the presence or absence of chemicals such as drugs or poisons. 164


Toxicological samples are collected for postmortem toxicology ONLY if the legal authority has authorized such investigation. As always, the chain of custody and proper labeling of each sample is critical for future admission into a courtroom as evidence. Possible samples from the deceased include the following: Vitreous humor (clear gel-like fluid that fills the space between the lens and the retina of the eye) Urine Stomach contents Liver Hair (for drug analysis) When the autopsy is finished all the organs are put back into the body cavity and packed with filling material. All cuts and incisions are closed up with strong twine sutures.

165


166


Exercises for Unit Twelve Short Answer

Why is it important for the pathologist to understand some of the circumstances behind the death?

Under what circumstances should the pathologist/medical examiner/coroner visit the scene of the death?

What would be accomplished by the pathologist seeing the body at the scene?

Name the limitations of the autopsy.

167


Name three reasons why the autopsy report is valuable.

List the steps in the autopsy protocol and give a brief description of each.

168


Practice your Protocol! Go to the following webs site and perform the animated autopsy. Animated Autopsy site:

http://www.deathonline.net/what_happens/autopsy/autopsy_steps.cfm Click on the link in the upper right of the screen.

Then go to http://www.pathguy.com/autopsy.htm and read a more detailed description about the autopsy. Answer the questions below: What does autopsy mean?

How many pathologists are present during the autopsy according to this website?

What does "Hic locus est ubi mors gaudet succurrere vitae" mean and what is the significance of the words?

How does the pathologist know the man in the autopsy had fatty liver?

169


Go to this page:

http://www.deathonline.net/what_happens/autopsy/autopsy_instruments.cfm and

read about the various autopsy instruments. Click on the link in the upper

right of the screen.

List the 8 instruments highlighted on the website below and give a brief description of each:

170


New Technology An amazing advancement in autopsy procedure using state of the art medical equipment. Virtual Autopsy

http://www.youtube.com/watch?v=1bVL9kbvfWY

Describe this new technology in your own words:

How will this change forensic science?

How can this technology help solve crimes?

The autopsy report has come back for Miss Sally and it is inconclusive. Search the internet using the terms “inconclusive autopsy” and find some examples to get a better understanding of what this means. You know that the window was left open for at least a few hours and that the temperature outside was bitterly cold. What effect can this have on the determination of the post mortem interval?

171


172


Unit Thirteen – Forensic Entomology, Anthropology, and Odontology

173


174


Unit Thirteen – Forensic Entomology, Anthropology, and Odontology (Dentistry) All living things decompose when they die and the extent of decomposition is used to estimate the time of death or post mortem interval. Watch the following video to learn more about the life of a forensic entomology student. http://www.youtube.com/watch?v=dntO3YANo18

Stages of Decomposition Within two days after death: • Initial decay • Cells start to die and burst open. • Green and purplish staining occurs from blood decomposition. • Skin takes on a marbled appearance. • Face becomes discolored. After four days: • Putrefaction • Skin blisters. • Abdomen swells with carbon dioxide (released by bacteria living in the intestines). Within six to ten days: • Putrefaction • Corpse continues to bloat with carbon dioxide as bacteria continue to feed on tissues • Eventually, gas causes chest and abdominal cavities to burst and collapse. • Fluids begin to leak from body openings as cell membranes rupture • Eyeballs and other tissues liquefy • Skin sloughs off 175


Forensic entomology is a broad field that deals with the identification of and use of insects and other related bugs to solve legal investigations and crimes. There are three main groups that forensic entomology can be subdivided into: • Medicolegal – This subgroup deal with looking at deceased human remains and studying the organisms that feed on and infest human remains. • Urban - This subgroup deals with insects which affect humans as they live in their immediate environment. Insects can feed on the living as well as the dead and the wounds left behind can often be misconstrued as abuse. Forensic entomologists involved in urban cases will often be required in civil as well as criminal cases. • Stored product pests – This subgroup deals with insects that get into the food supply and cause contamination. Like the urban forensic entomologist, this group could involve both civil and criminal cases. How do Forensic Entomologists Help Solve cases? One of the most important aspects of forensic entomology is helping the criminal investigators, pathologist, and prosecutors determine a post-mortem interval, or time of death. You have already learned that a post mortem interval can be determined from body cooling, but what if the body has been dead for several days? In that case body temperature will have no bearing on how the time since death is determined. This is when a forensic entomologist enters the investigation. If a body is found decomposing there will be clues that the forensic entomologist can use to determine when the death occurred. Typically this is called “time since colonization” and refers to the time since insect infestation took place. The most common insect found on 176


decomposing bodies is the blow fly but any insect that has a larval stage can be present and useful to investigators. The life cycle of the blow fly is illustrated below:

Stage

First Appearance

Stage Duration

Egg

Soon after death

8 hours

Larva 1 (Instar 1)

1.8 days

20 hours

Larva 2 (Instar 2)

2.5 days

15-20 hours

Larva 3 (Instar 3)

4-5 days

36-56 hours

Pre-pupa

8-12 days

86-180 hours

Early and late pupa stages

18-24 days

6-12 days

Adult

21-24 days

177

Several weeks


These general timing guidelines can help establish an approximate time of death for cases involving bodies already involved in the decomposition process. Forensic Anthropology Forensic anthropology is used when the recovered body has been dead longer than the decomposition process, i.e. there are only skeletal remains left. This approach can also be used for badly disfigured fire victims. The forensic anthropologist can often determine if the remains came from a male or female, the approximate age, whether or not they were in good or poor health, the race, and the height. Not all bones from the same body will always be found together and not all bones will necessarily belong to only one body, or to a human, so a forensic anthropologist can help determine all of those things as well. Like other forensic specialists, the forensic anthropologist will only look at evidence related to the skeletal remains of the deceased in question. They will not perform other forensic tests such as DNA testing leading to identification. That would be run by the DNA specialist. Forensic Dentistry Forensic dentistry, or Odontology, is the use of dental records to identify unknown persons, or those involved in a mass disaster such as airplane crashes or terrorist attacks. Forensic dentistry is limited to those unidentified persons who have dental records and such records are available. There is no way to identify the deceased if no records are available as there would be way to compare teeth and landmarks 178


inside the mouth to x-rays or dental charting documents. Sometimes the approximate age of the deceased can be determined by the teeth without prior records. Matching up bite marks with an object or tissue is another use for forensic dentistry. When using dental records for identification the forensic dentist will look inside the mouth and take x-rays so they can chart all existing landmarks such as: • Fillings • Crowns – and whether or not they are gold or porcelain • Root Canals • Implants • Anatomical anomalies such as fluorosis markings on teeth or absence of teeth A typical dental chart looks like the document below:

179


180


Exercises for Unit Thirteen Understanding the Blow Fly Lifecycle

Go to the following website to read more about the lifecycle of the blow fly. http://www.deathonline.net/decomposition/corpse_fauna/flies/life_cycle.htm

Answer the questions below: Why is knowing the different stages of the blow fly’s lifecycle important for forensic entomologists? Because they can determine the time since death, or a close approximation of it, but looking at the stage of development of the maggots.

181


Using the diagram and website above – describe how each stage of the blow fly’s lifecycle differs and what that stage can tell forensic scientists about the time of death. Eggs

Larva - 1st instar

Larva - 2nd instar

Larva - 3rd instar

182


Pre-pupa

Pupa

Adult fly

183


Read about the stages of decomposition on the first page of this unit again and then watch this time lapse photography video of a decomposing pig at the link below: http://www.youtube.com/watch?v=QqZAVbC9uRk&feature=related

Describe what is happening to the pig at these specific times in the video (you will have to pause the video at each time specified to make notes). What is happening in the movie at: 0.09 seconds –

0.40 seconds –

0.47 -1.00 minutes –

1.11 – 1.20 minutes –

1.52 minutes –

184


Forensic Anthropology

Watch the following video about what it means to be a forensic anthropologist: http://www.youtube.com/watch?v=UNgx2FLQea4 Then watch how anthropologists find clues about mummies

http://videos.howstuffworks.com/hsw/11815-forensics-anthropology-andmummies-video.htm

And how weather conditions can influence decomposition:

http://videos.howstuffworks.com/hsw/15896-rotten-but-not-forgotten-climateand-time-video.htm

How do very dry conditions effect decay?

How does freezing temperatures effect decay? Describe some things forensic anthropologists discovered about the Iceman.

185


Which part of the country would have a decreased decomposition time?

Which part of the country and season of the year would have an increased decomposition time?

Which types of clothing decompose very quickly and which types of fibers decompose slower?

Forensic Dentistry

Watch the following video about a forensic dentist: http://www.youtube.com/watch?v=DKeEbVLZNWc

What is the major work of a forensic dentist?

What type of situations would require a forensic dentist?

Why would DNA samples be taken for victims with bite marks?

What are dental models used for in forensic dentistry?

186


Unit Fourteen – Pharmacology and Toxicology

187


188


Unit Fourteen – Pharmacology and Toxicology In order to understand how these two disciplines effect the field of forensic science there must be an understanding of the terms associated with each. Pharmacology is the study of drugs, of the body's reaction to drugs, the sources of drugs, their nature, and their properties. A drug is an exogenous (introduced to the body from the outside) chemical that is capable of modifying physiological function within an organism. A chemical can be any compound. A compound is two or more elements are bonded together in a fixed mass ratio that can be split into simpler substances. Almost anything can be considered a drug if it is used to change the physiological behavior of an organism. Toxicology is the study of poisons. Specifically, it is the study of the adverse effects of chemicals on living organisms. A poison is referred to in general terms as a chemical that can cause adverse effects, but that is as simplistic definition because almost all drugs can become poisons when taken in the wrong dose. A dose is the optimal amount of drug needed to illicit the desired effect on an organism where adverse effects are less than desired effects. It is typically based on purity of the chemical and age, body weight, and tolerance of the individual to the drug being used. Forensic toxicology is a combination of analytical chemistry and basic toxicology and is primarily concerned with the medicolegal aspects of harmful effects of chemicals on humans and animals. Forensic 189


toxicology uses many different aspects of the pharmacology, chemistry, biochemistry, and physiology fields. Toxicology is concerned with 4 basic physiological mechanisms, or phases, in the body: • • • •

Absorption Distribution Metabolism Excretion

Absorption – absorption differs according to how the drug or poison was administered. Given orally, or through the mouth, a drug will often lose some or much of its potency because of first pass metabolism. First pass metabolism simply means that prior to going into the blood stream to be carried to the target organ; it first passes through the liver. The liver is like one big filter and will often significantly “deactivate” drugs with certain properties. If a drug or poison is administered through an IV directly into the blood stream the absorption is almost immediate, as are the effects. Distribution – in this phase the toxicant (drug or poison) exits the blood and enters the space between the cells or goes directly into the cells. This is the phase in which the toxicant will reach the site of action called the target organ. Many things will affect the rate of distribution such as membrane transport, but these molecular mechanisms are beyond the scope of this course.

Metabolism – is the process of changing the drug as it passes through the body. This is done by means of enzymes. Enzymes are protein molecules that catalyze biochemical reactions. In simple terms, they are small chemicals your body makes in order to make chemical 190


reactions speed up. These enzyme reactions will either result in a more or less toxic drug. Most of the time it is a less toxic version of the initial drug or poison, but there are exceptions to every rule. Excretion – is the removal of the drug or poison from the blood and into pathways that will eliminate it from the body. The major pathway for excretion is through filtration in the kidney and then elimination through the urine, but some chemicals will be excreted through feces, sweat, breast milk, and exhalation. The manner of excretion is dependent on the physical and chemical properties of the drug as it is metabolized. In addition, in forensic toxicology there is also an emphasis on analytical chemistry, which is the laboratory methods used to determine the identity and exact amount of unknown substances suspected in a criminal investigation. There will be another unit later in the course dedicated to analytical methods. These unknown substances can come from the crime scene, a living suspect or victim, or a deceased suspect or victim. The dose of poisoning or “overdose” is also critical information as are any drug interactions that may have contributed to the death of the victim. That is why separation and concentration of the drugs or drugs using analytical methods is so important. Like all the other aspects of forensic science, all biological specimens must be maintained within the chain of custody in order to be valid in a courtroom. The following chart illustrates how absorption, distribution, metabolism, and elimination occurs in the body: 191


The chart above states this: At any stage in the absorption, distribution, metabolism, and elimination phases, the drug has at least two possible pathways. The pathway of toxicity and the pathway of detoxicity. These pathways are not an either/or choice. That means that some of the time the metabolism of the drug might make it less toxic and some of the time 192


it might enhance its toxicity. It can, effectively, jump the arrow down the middle and participate in all any metabolic pathway according to its physical properties. The column on the left is the pathway of toxicity. Along the way the molecule changes as it is metabolized, but when it reaches the target organ at the end of the pathway, it is still a toxic molecule. The pathway on the right is the pathway of detoxification. The molecule changes as it is metabolized, but by the time it reaches the target molecule it is not toxic. The molecular mechanisms that allow each of the pathways to function are too complicated to go into in this course, but if you are interested in this type of science you should consider taking biochemistry. Pharmacology deals with the pathway on the right. The purpose of medicinal drugs is to provide physiological changes in the body by having the drug reach the target organ without causing toxicity to the patient. Regardless of how diligent drug research and production is, all drugs have risk and side effects.

193


194


Exercises for Unit Fourteen Vocabulary Define the Following: Pharmacology

Drug

Chemical

Compound

195


Toxicology

Poison

Dose

Forensic toxicology

Absorption

. 196


Distribution

Metabolism

Excretion

Toxicity

Detoxification

197


Label the chart:

198


Explain the difference between the right and left sides of the chart.

Go to:

http://www.biocreations.com/animations/Nov1demo.swf

This website has two animations for you to look at. The one on the left is how a drug behaves when it is injected directly into the blood stream, or an IV. The animation on the right shows how a drug behaves when it is taken by mouth, or orally. Why are these two pathways to absorption, distribution, metabolism, and excretion so different?

199


200


Unit Fifteen – Drug Scheduling and Illegal Drugs

201


Unit Fifteen – Drug Scheduling and Illegal Drugs

When drugs are involved in a death, much of the time they are illegal or controlled substances. In this unit we will go through the “recreational” or illegal drugs and how they relate to forensic science, the crime scene, and death investigation. In the next unit we will visit prescription and over the counter drugs and how they too, can be used to cause harm to oneself or others. The most commonly abused illegal drugs found during a criminal investigation are: • Marijuana (cannabis) • Cocaine • Meth Amphetamine • Heroin • PCP • LSD • MDMA Recognizing these drugs in their unused form as well as the symptoms and side effects are part of the criminal investigation. The toxicology report will be the final determination of what the suspected drug actually is, but a good investigator must know how to collect the evidence as well as how to store it until analysis can be done. In addition, recognizing that a suspect or victim might need immediate medical attention is also part of what law enforcement does. The Controlled Substances Act places all drugs into one of five schedules. This placement is based upon the substance's medical use, potential for abuse, and safety or dependence liability. The following are brief definitions of each of the schedules, together with examples of drugs, which are included in those schedules. 202


Schedule I The drug or other substance has a high potential for abuse and no currently accepted medical use in the United States. Typically there is a lack of accepted safety for use of the drug or other substance under medical supervision. Examples include heroin, LSD, marijuana. Schedule II Like schedule I, schedule II drugs are considered to have a high potential for abuse that may lead to severe psychological or physical dependence. Schedule II drugs differ from schedule I in that these compounds do have a currently accepted medical use in the United States or a currently accepted medical use with severe restrictions. Examples are morphine, PCP, cocaine, and methamphetamine. Schedule III The drug or other substance has a potential for abuse less than those compounds listed in Schedules I and II. These compounds have a currently accepted medical use in the United States, even though abuse of the drug may lead to moderate or low physical dependence or high psychological dependence. Examples include anabolic steroids, Codeine and Hydrocodone with aspirin or Acetaminophen.

Schedule IV The drug or other substance has a low potential for abuse relative to the drugs or other substances in Schedule III. These compounds also have a currently accepted medical use in the United States. Abuse of the drug may lead to limited physical dependence or psychological dependence relative to Schedule III drugs. Included in Schedule IV are the benzodiazepines such as Diazepam, Oxazepam etc.

203


Schedule V The drug or other substance has a low potential for abuse relative to the drugs or other substances in Schedule IV, and has a currently accepted medical use in treatment in the United States. Abuse of Schedule V drugs may lead to limited physical dependence or psychological dependence relative to the drugs included in Schedule IV. Over-the-counter cough medicines with codeine are classified in Schedule V. Marijuana - Three drugs come from the cannabis plant- marijuana, hashish, and hashish oil – and all are distributed on the U.S. illicit market. None of these drugs have any accepted medical use in treatment in the United States, they remain under Schedule I of the CSA. Cocaine - There are two chemical forms of cocaine: the hydrochloride salt and the "freebase." The hydrochloride salt, or powdered form of cocaine, dissolves in water and, when abused, can be taken intravenously (by vein) or intranasally (in the nose). Freebase refers to a compound that has not been neutralized by an acid to make the hydrochloride salt. The freebase form of cocaine is smoked and is called crack cocaine. Cocaine is a Schedule II stimulant because it has high potential for abuse but can be administered by a doctor for legitimate medical uses, such as a local anesthetic for some eye, ear, and throat surgeries. Meth Amphetamine - Methamphetamine is a Schedule II stimulant, which means it has a high potential for abuse and is available only through a prescription that cannot be refilled. There are a few accepted medical reasons for its use, such as the treatment of narcolepsy, attention deficit disorder, and - for short-term use obesity; but these medical uses are limited. 204


Heroin - Heroin is a Schedule I substance under the Controlled Substances Act because it is highly addictive. Heroin is processed from morphine, a naturally occurring substance extracted from the seedpod of the Asian poppy plant. Heroin usually appears as a white or brown powder. There are tremendous withdrawal symptoms that go along with heroin addiction and recovery and the success rate of recovery is not good. PCP - PCP is a white crystalline powder that is readily soluble in water or alcohol. It has a distinctive bitter chemical taste. PCP can be mixed easily with dyes and turns up on the illicit drug market in a variety of tablets, capsules, and colored powders. It is normally used in one of three ways: snorted, smoked, or eaten. It is a Schedule II hallucinogenic drug under the CSA but really has no medicinal value. LSD - LSD is sold on the street in tablets, capsules, and occasionally in liquid form. It is an odorless and colorless substance with a slightly bitter taste that is usually ingested orally. It is often added to absorbent paper, such as blotter paper, and divided into small decorated squares, with each square representing one dose. MDMA - is a synthetic, psychoactive Schedule I drug that is chemically similar to the stimulant methamphetamine and the hallucinogen mescaline. It is commonly found in brightly colored tablet form and often contains many more chemicals that just the MDMA itself. One of the biggest concerns of any forensic laboratory (and the point of attack for many defense attorneys) is the possibility of sample contamination. Every effort must be made to avoid the possibility of contamination between samples and/or between the sample and a drug standard. When samples are acquired for testing the appearance and features of the substance must be recorded. These features include: 205


• Weight if in powder form (must also note whether or not it is dry weight or wet weight) • Amount if in tablet form • Number of packages • Nature of the substance • Color • Odor (if obvious) • Condition - wet or dry Many drugs are not chemically stable and can be subject to degradation via the following mechanisms: • Chemical - can result in loss of pure drug by breakdown to another compound • Physical – can result in physical changes in the form of a drug • Microbial – can occur in any sample that contains water It is very important that the physical and chemical properties of the drug to be tested are kept intact. You will learn more about the importance of this in the analytical chemistry unit.

206


Exercises for Unit Fifteen Name 5 Schedule I drugs and tell how they are used:

Name 5 Schedule II drugs and tell how they are used:

207


Name 5 Schedule III drugs and tell how they are used:

Name 5 Schedule IV drugs and tell how they are used:

208


Name 5 Schedule V drugs and tell how they are used:

Explain the three mechanisms for drug degradation:

209


Take one of these two cool toxicology tutorials: Free Toxicology Distance Education from NIH – this is a great class that can really help a high school student get an edge on chemistry and biochemistry in college. http://sis.nlm.nih.gov/enviro/toxtutor/Tox1/a11.htm

OR Learn about the toxins produced by the black widow and brown recluse spiders!

http://www.rxlist.com/spiders_slideshow_black_widow_vs_brown_recluse/article. htm

210


Unit Sixteen – Prescription Drugs

211


212


Unit Sixteen – Prescription Drugs Not all abused drugs are illegal to possess and most of the time these drugs are available with a treating doctor’s prescription, and in this case, are legal. Sometimes, however, these prescription drugs can be obtained in such as way that possession of them is illegal. In addition, just because a person is taking legally prescribed drugs, does not mean that they are exempt from responsibility. Many prescription drugs have adverse side effects and consequences that must be kept in mind. For example, if a person is taking a legally prescribed narcotic pain reliever such as codeine and hits another car while driving, they would be cited for “driving under the influence” even though the drug was obtained from a legal prescription. The most commonly used/abused legal or prescription drugs involved in crimes are: • • • •

Hypnotics Sedatives Opioids Ethanol

All of the above drugs have the ability to depress the nervous system. Basically that means your reflexes slow down and your thoughts are not as clear. A sedative drug such as the sleep aid Lunesta will decrease activity and excitation which will calm down the person taking the drug. A hypnotic is commonly a sedative drug given at a higher concentration such as diazepam (better known as Valium) and will make the person sleepy. The opioids are narcotics that are commonly used for pain relief. 213


Ethanol is the scientific name for alcoholic drinks such as beer, wine, and liquor. Each of these examples can be used both legally (when prescribed by a doctor for a legitimate reason) and illegally (obtained through other means and used for recreational purposes). Legal ways to use these prescription drugs: • To control pain after an injury or surgical procedure • To aid in treatment of diagnosed sleep disorders • To aid in treatment of diagnosed anxiety Ethanol is not commonly used in the US for pain or anxiety control, but in other parts of the world where better alternatives are not available, it can be used in that fashion. All central nervous system depressants will restrict the user from performing certain activities. If a crime occurs while an individual is on prescription medication and they were warned about restraining from certain activities, they will not be excused from the consequences of the crime. For example: Mr. Brown was given a prescription for a sleep aid because he was walking in the middle of the night and was unable to fall back asleep. When he filled his prescription at the pharmacy the pharmacist warned him of taking the drug too late at night. If he did not take the drug at least 9-10 hours prior to when he expected to wake up (the length of time needed for all effects of the drug to be eliminated), he would feel groggy and his reflexes would be slow. Not only that, driving while on this drug was illegal.

214


Mr. Brown took his pharmacist’s advice and made sure he had ample time for the drug to wear off before he needed to get ready for work the next day. After being asleep for about 4 hours he was awaken by the ringing phone and was alerted to a family member being in the hospital. He got up, got dressed, got into his car and fell asleep at the wheel, hitting another car in the process. Was Mr. Brown responsible for his accident? Yes. Mr. Brown was warned that driving while on this drug was prohibited, thus he broke the law. Driving while under the influence of certain prescription drugs is the same thing as driving drunk. It is never OK to drive while consuming alcohol and the first responder to Mr. Brown’s accident would most likely assume he had been drinking and proceed with sobriety testing. It would become clear that something was wrong with Mr. Brown, even though he was able to pass the Breathalyzer test. The Breathalyzer is specific for ethanol. That means it can only test for alcohol levels and not any other drug. Mr. Brown would then be asked to submit to a drug test and through analytical chemistry (discussed in the next unit) it would be discovered that he had taken a prescription sleep aid just a few hours before the accident. If other people were hurt from his accident, he could be in very serious trouble. Sometimes people take prescription drugs and don’t go out and commit crimes. This scenario can also be illegal. 215


For Example: Mr. Brown’s doctor decided that he had been taking his sleep aid medication for too long and was at risk for dependency (addiction) and so he stopped giving him a prescription. Mr. Brown, however, discovered that his co-worker had a few refills left on his sleep aid prescription and started taking them instead. He never did drive a car after taking his pills, but his actions were still illegal. Why? Mr. Brown’s co-worker’s prescription was specific for a certain person. That means no one else is legally allowed to take the pills prescribed to another person. Mr. Brown was not only addicted to sleeping pills, but he was breaking the law as well. Many prescription drugs are highly addictive, especially those prescribed for pain relief. It is easy for someone to become dependent on these drugs and many will find illegal ways to obtain them. In fact, many criminals who sell illegal drugs will also sell legal drugs that have been obtained through the prescriptions of bad doctors. There are severe punishments for doctor’s who write illegal prescriptions as well as those who forge prescriptions to gain access to drugs with a high level of dependency. Most states have in place a prescription drug monitoring program which can keep track of filled prescriptions. Recent research has shown that most people who use prescription drugs illegally rely on legitimate prescriptions written for family members and friends as their primary way for obtaining the pills.

216


These prescription drug monitoring programs (PDMP) allows physicians and pharmacists to gather information about the patients they serve and to make sure the drugs they are prescribing are appropriate. For instance, if a patient is taking codeine, the physician would be able to review when the patient was first prescribed the drug, how many other doctors have prescribed this drug for the patient, how often it was prescribed, and from what pharmacies the patient is receiving the controlled drugs. The physician would then determine whether the patient is taking the medication appropriately or making other uses of it, such as selling, and/or risks becoming dependant on it. The information collected by the PDMP is only accessible to physicians who prescribe the controlled substances and pharmacists. While patients may access their own personal data by contacting the program, law enforcement officials can only obtain information specific to an individual by the presentation of a subpoena or court order.

217


218


Exercises for Unit Sixteen

Define the following and give an example of each Hypnotics –

Sedatives –

Opioids –

Ethanol -

Prescription Drug Abuse

Watch the following video: http://www.webmd.com/video/prescription-drug-abuse

Name a few prescription drugs that are commonly abused.

219


Go to the following websites to learn more about the science of addiction: http://www.hbo.com/addiction/understanding_addiction/index.html?current=0

Answer the following questions: What is addiction –

What are some key characteristics of addiction –

220


Why do some people become addicted and others don’t–

Name three Myths of addiction –

The Science of Addiction – Explore the following website about how drugs affect the brain. http://learn.genetics.utah.edu/content/addiction/ http://learn.genetics.utah.edu/content/addiction/drugs/ http://learn.genetics.utah.edu/content/addiction/drugs/cerebral.html

221


Explain how dopamine can alter the brain and how that relates to drug addiction. You might have to do a search on the internet to find all your information.

How do people die of drug overdose?

222


Why are teens that develop a drug habit more likely to become addicted?

223


224


Unit Seventeen – Preliminary and Confirmatory Drug Testing

225


226


Unit Seventeen – Preliminary and Confirmatory Drug Testing You might be wondering how arresting officers know that suspects they are detaining may be under the influence of illegal drugs. Realistically speaking, they don’t. But they can make use of certain instantaneous tests while out in the “field” to give them “probably cause” that the suspect may be under the influence of illegal drugs. Often a suspicious behavior will be cited as the reason for first contact. Perhaps they were driving erratically or maybe they were involved in a fight on a street corner. If the officer observes erratic behavior or finds a suspicious substance on the person or property of the suspect, then can then immediately evaluate whether or not this substance might possibly be an illegal substance. It is important to make one thing very clear – there is no field test that can absolutely say that a person carrying a white powder is carrying cocaine (or any other substance for that matter). What that field test tells the officer is that there is a high probability that the confiscated white substance is cocaine. Such field tests are called spot tests. They give law enforcement just enough evidence to make the actual arrest. Such tests are not enough to convict someone of a drug charge in a courtroom. Spot tests have pros and cons. Pros: • Such tests are quick and easy to perform. • Sophisticated equipment is not necessary as many preliminary tests come in kits for law enforcement. • Require minimal training. They do not require specific scientific expertise. 227


• Require minimal sample. Don’t need a whole lot of suspected drug to perform the test. Chart of Spot Testing and Color Changes: The reagent is added to the sample and a color change can indicate the class of drug. Sometimes no change is an indication of a drug class, such as those tests that test for methadone or opium. Reagent

Chemical Class

Initial Color

Final Color

Cobalt Thiocyanate

Cocaine, Crack

Blue

Dark Blue

Marijuana, hashish, THC Duquenois Reagent

Coffee (roasted) Patchouli oil Tea (leaves)

Grey

Violet Blue

Ehrlichs Reagent

Hallucinogens

Violet

Violet

Mandelin Reagent

Methadone

Green

Blue

Marquis Reagent

Opium Alkaloids

Purple

Purple

Cons: • Non-specific. They only give clues to what the substance may be, not what it definitively is. Spot tests, then are a form of preliminary testing. Preliminary drug tests allow drugs to be classified into a particular chemical group, but do not absolutely identify the presence of a specific chemical compound. A preliminary drug test or screening test, is used to eliminate “negative” samples from further testing and to identify the samples that require a more specialized test. When doing preliminary tests, five drug classes are screened for: 228


• Amphetamines • Cocaine • Opiates • Phencyclidine (PCP) • Marijuana When testing for each of the five drug classes, a different drug test kit is used for each drug class. There are other preliminary tests besides spot tests that can help the forensic toxicologist determine which class of drug they are dealing with. Thin Layer Chromatography (TLC) is one method that is commonly used to both separate the drug of interest from other unimportant components and detect which substance it is. Types of Preliminary Tests: • Spot or color change tests • TLC • Immunoassays – for more information about these tests visit:http://www.sparkanidea.com/portfolio/presentations/ELX/TF.html (Check all boxes and press play) Preliminary test results can then be used as a guide to the appropriate confirmatory tests or methods that need to be applied to determine and verify the structure of the chemical compounds present in a drug related sample. Confirmatory tests then have the following Pros and Cons. Pros: • Will absolutely determine what chemical compound is present • Will hold up in a courtroom Cons: • Requires expensive equipment and laboratory setting • Time-Consuming 229


• Requires specialized personnel to run the tests • Requires specialized personnel to interpret the data Gas chromatography in combination with Mass Spectrometry is the gold standard of forensic toxicology. Go to the link below and click NEXT EXAMPLE to watch the animation before you read further. http://www.shsu.edu/~chm_tgc/sounds/flashfiles/GCMS.scrubber.swf

You must understand that there are two parts to figuring out what an unknown sample of drug is. Let’s use cocaine as an example: The first part has to do with separating the drug from all the other things that might be in the powder with it. Cocaine is never pure. It is often mixed with other chemicals that have the same appearance – white powder, or properties – numbing. Lidocaine is a popular drug that is mixed with cocaine. You might have guessed that lidocaine is related to cocaine just by looking at their names, and you’d be right. They are is the same class of drug, so if a color spot test was used on a pure sample of each, both would change color and will give a false positive. Reagent

Chemicals

Initial Color

Final Color

Cobalt Thiocyanate

Cocaine and Lidocaine

Blue

Dark Blue

This is why a confirmatory test must also be performed. The separation technique illustrated in the preliminary testing section was TLC. You can also separate samples using liquid-liquid extraction and solid phase extraction. See examples of both of these techniques here: 230


Thin Layer Chromatography Animation Liquid-liquid Extraction & Solid Phase Extraction

The next step in confirmatory testing is the analyzer. In Gas Chromatography/Mass Spectrometry (or GS/MS for short) the GC part is the separation technique and the MS part is the analyzer technique. Here is another animation of the GC/MS process. Don’t worry if you can’t understand everything – most graduate students have trouble understanding this animation: http://www.unsolvedmysteries.oregonstate.edu/MS_05 Just watch for the basic processes outlined below: •

•

•

•

•

•

• •

Assume that the components of the cocaine sample are the blue, red, and green dots in the animation They undergo ionization (lose an electron) and fragmentation (split up) The charged fragments (blue, red, and green) are separated by mass (mass is *like* weight) The fragments exit and pass into the detector to be identified on a mass spectrum Each fragment is a pure substance. Many times the sample of drug is mixed with other things. Cocaine is often mixed with lidocaine to make it less pure. Scientists must remove the lidocaine (and all other impurities) in order to get a pure sample to analyze. GC and TLC are the techniques used for separation. MS is the technique used to analyze and identify the substance.

Most important point – the mass spectrometer identifies the molecule based on its unique structure and this cannot be confused 231


with any other chemical compound. Lidocaine and cocaine are very similar and can be confused with the color test. But at the end of the GS/MS test the person who analyzes the data will NOT be confused be the two molecules. They will look completely different on the print out. See below:

Cocaine (Above)

Lidocaine (Above)

232


Exercises for Unit Seventeen Careers under the Microscope

While there are certainly many jobs relating to forensics, there is one more laboratory specialty that should be mentioned and that is the Medical Technologist. The medical technologist requires less training than a forensic toxicologist (minimum degree for a toxicologist is a Master’s of Science and a PhD is preferred) but performs much of the same analytical testing. Why type of work does the Medical Technologist do? Clinical laboratory testing plays a crucial role in the detection, diagnosis, and treatment of disease. Medical laboratory technologists perform most of these tests. A medical technologist (MT) is a healthcare professional who performs diagnostic analytic tests on body fluids such as blood, urine, sputum, stool, cerebrospinal fluid (CSF), peritoneal fluid, pericardial fluid, and synovial fluid, as well as other specimens. Medical technologists work in clinical laboratories at hospitals, doctor's offices, reference labs, and within the biotechnology industry Technologists also prepare specimens for examination, count cells, and look for abnormal cells in blood and body fluids. They use microscopes, cell counters, and other sophisticated laboratory equipment. They also use automated equipment and computerized instruments capable of performing a number of tests simultaneously. After testing and examining a specimen, they analyze the results and relay them to physicians. With increasing automation and the use of computer technology, the work of technologists and technicians has become less hands-on and more analytical. The complexity of tests performed, the level of 233


judgment needed, and the amount of responsibility workers assume depend largely on the amount of education and experience they have. Clinical laboratory technologists perform complex chemical, biological, hematological, immunologic, microscopic, and bacteriological tests. Technologists microscopically examine blood and other body fluids. They make cultures of body fluid and tissue samples, to determine the presence of bacteria, fungi, parasites, or other microorganisms. Technologists analyze samples for chemical content or a chemical reaction and determine concentrations of compounds such as blood glucose and cholesterol levels. They also type and cross match blood samples for transfusions. Clinical laboratory technologists evaluate test results, develop and modify procedures, and establish and monitor programs, to ensure the accuracy of tests. Some technologists supervise clinical laboratory technicians. Technologists in small laboratories perform many types of tests, whereas those in large laboratories generally specialize. Clinical chemistry technologists, for example, prepare specimens and analyze the chemical and hormonal contents of body fluids. • Microbiology technologists examine and identify bacteria and other microorganisms. Blood bank technologists, or immunohematology technologists, collect, type, and prepare blood and its components for transfusions. • Immunology technologists examine elements of the human immune system and its response to foreign bodies. Cytotechnologists prepare slides of body cells and examine these cells microscopically for abnormalities that may signal the beginning of a cancerous growth. Molecular biology technologists perform complex protein and nucleic acid testing on cell samples. 234


Clinical laboratory personnel are trained to work with infectious specimens. When proper methods of infection control and sterilization are followed, few hazards exist. Protective masks, gloves, and goggles often are necessary to ensure the safety of laboratory personnel. Training and Education Requirements The usual requirement for an entry-level position as a clinical laboratory technologist is a bachelor’s degree with a major in medical technology or one of the life sciences; however, it is possible to qualify for some jobs with a combination of education and on-the-job and specialized training. Universities and hospitals offer medical technology programs. Bachelor’s degree programs in medical technology include courses in chemistry, biological sciences, microbiology, mathematics, and statistics, as well as specialized courses devoted to knowledge and skills used in the clinical laboratory. The National Accrediting Agency for Clinical Laboratory Sciences (NAACLS) fully accredits about 470 programs for medical and clinical laboratory technologists, medical and clinical laboratory technicians, histotechnologists and histotechnicians, cytogenetic technologists, and diagnostic molecular scientists. Some States require laboratory personnel to be licensed or registered. Licensure of technologists often requires a bachelor’s degree and the passing of an exam, but requirements vary by State and specialty. Information on licensure is available from State departments of health or boards of occupational licensing. Certification and other qualifications. Many employers prefer applicants who are certified by a recognized professional association. 235


Associations offering certification include the Board of Registry of the American Society for Clinical Pathology, the American Medical Technologists, the National Credentialing Agency for Laboratory Personnel, and the Board of Registry of the American Association of Bioanalysts. These agencies have different requirements for certification and different organizational sponsors. Advancement. Technicians can advance and become technologists through additional education and experience. Technologists may advance to supervisory positions in laboratory work or may become chief medical or clinical laboratory technologists or laboratory managers in hospitals. Manufacturers of home diagnostic testing kits and laboratory equipment and supplies also seek experienced technologists to work in product development, marketing, and sales. Professional certification and a graduate degree in medical technology, one of the biological sciences, chemistry, management, or education usually speeds advancement. A doctorate usually is needed to become a laboratory director. Federal regulation requires directors of moderately complex laboratories to have either a master’s degree or a bachelor’s degree, combined with the appropriate amount of training and experience. Job Outlook Rapid job growth and excellent job opportunities are expected. Most jobs will continue to be in hospitals, but employment will grow faster in other settings. Earnings Median annual wage-and-salary earnings of medical and clinical laboratory technologists were $49,700 in May 2006. The middle 50 percent earned between $41,680 and $58,560. The lowest 10 percent earned less than $34,660, and the highest 10 percent earned more than $69,260.

236


Median annual earnings in the industries employing the largest numbers of medical and clinical laboratory technologists were: Federal Government

$

57,360

Medical and diagnostic laboratories

50,740

General medical and surgical hospitals

49,930

Offices of physicians

45,420

Colleges, universities, and professional schools

45,080

237


238


Unit Eighteen – The Toxicology Report

239


240


Unit Eighteen – The Toxicology Report

Once it has been determined that an autopsy is necessary the following specimens should be collected for further toxicological analysis: Blood If available, two blood specimens should be collected, one from the heart and the other from a peripheral (arm, leg, etc) vein. In some cases the heart blood may be contaminated from the release of drugs from other tissues and make interpretation difficult or impossible. In such cases the alternate blood sample can be used. The concentration of drugs in the blood is directly related to dose and is therefore the most useful specimen for determining the effect of the drug on the individual at the time of death. The stability of the particular drug in the blood or other biological fluids should be considered if a significant amount of time has passed between the time of death and collection of biological samples. Urine Drugs and metabolites can accumulate in the urine for a period of days after administration. Urine drug concentrations are typically much higher than blood concentrations. It should be noted however, that urinary drug concentrations bear little or no correlation with the effects being experienced by the deceased at the time of death. The presence of a drug or poison in the blood along with the absence of the same drug in the urine, means that death happened very quickly after exposure and the drug was not yet metabolized. No direct correlation between urine drug concentrations and actual ingestion levels can be made because of metabolic processes. Liver and Bile Liver and bile drug concentrations can determine the presence of a drug, but like urine, no direct correlation can be made about how much drug or poison was ingested. 241


Vitreous humor Vitreous humor is relatively stable and does not putrefy as rapidly as other specimens. Many assays for drugs have been described in post mortem vitreous humor and it is widely used for ethanol. Cons of using vitreous humor are: limited specimen volume and the limited interpretative value of analytical results. Other Brain, lung, spleen and stomach contents may be useful, depending on the nature of the drug or toxicant involved in the particular case. Samples and Receiving As with all forensic evidence, without proper collection, handling and documentation, it is completely useless. The pathologist should be informed of the type and minimum amount of samples that should be collected. Extra sample should be collected, if possible, so repeat testing can be done by other involved parties and/or defense lawyers. Packaging, conditions, and shipping requirements for any samples that need to be transported to other laboratories should be carefully defined e.g. keep frozen or refrigerated. Specimens from living persons that could carry an infectious disease should be identified and clearly marked as such. The anatomical site collection should be noted for each specimen (particularly peripheral or heart blood). Chain of custody forms should accompany all evidence, without which the laboratory cannot be certain that the evidence remained intact and free from contamination between its collection and examination. It is up to the certifying toxicologist to plainly state on the report that chain of custody has been properly maintained. If this is a legal 242


prosecution, they will be called into court to testify that such conditions were met. Specimens received by the laboratory should first be examined to ensure that they are intact, sealed and that the appropriate signatures and paperwork is present. The sample should then be logged in to the laboratory's tracking system. Example of a chain of custody form can be found at his link: http://www.mselabs.com/forms.htm

There is no simple way to detect all of the drugs and other poisons that might have been ingested by a patient because a wide variety of substances may be involved. These substances include: • Gases • Volatile liquids • Inorganic metal salts • Pharmaceutical products • Illicit drugs • Herbicides • Pesticides • Poisons Patients may also ingest cocktails (combinations of several drugs at once) of substances. Often these drugs will be in combination with alcohol. Stomach contents can be useful to the investigation because pills can often be found still partially intact. It would be impossible to test for all possible drugs and poisons that might have contributed to the death of a victim and so the toxicology lab must be told the circumstances of each case in order to perform the screening in the most time and cost effective way. 243


A “typical” screening panel would include the most common drugs of abuse and death. The absence of drugs and poisons is also very helpful to the investigation as it eliminates possible causes and scenarios.

The following page contains the toxicology report for Miss Sally.

244


Rocky Mountain Toxicology Laboratory 1200 Main Street Rocky, CO Date - 01-15-2009 Case # - 11223 Patient – Sally Smith Age/Sex – 21/F Reg Dr. – Medical Examiner, District 1 TEST Cannabis Ethanol Cocaine metabolites Amphetamine Opioids Benzodiazepines Barbiturates Arsenic Cyanide Carbon Monoxide ethanol

DOB – 12-18-1988

RESULT Negative Negative Negative Negative Negative Negative Negative Negative Positive Negative Negative

Concentration mg/L 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 8.50 0.00 0.00

Positive cyanide sample from cardiac blood. No cyanide present in urine. Specimens were intact upon receipt. Chain of Custody, specimen security, and integrity has been maintained. Testing has been performed as requested by Medical Examiner under their direction. All in-house analysis have been conducted by Rocky Mountain Toxicology Laboratory employees who have received special training and education in the procedures performed and are licensed in the state of Colorado as Medical Technologists.

Reviewed By:

Date: 01-16-2009

J. Anne Huss, Pharm. D

245


246


Exercises for Unit Eighteen Cyanide Poisoning

You may have noticed that Miss Sally’s toxicology report has finally come back to the investigators. It is not uncommon for lab tests to take weeks or even months. Some of it has to do with the fact that these tests can be time consuming, but for the most part it is because there are more lab tests to be run than there are people and equipment to run them. A simple case of resource shortage. The tox report showed a bunch of chemicals that came up negative – and one very interesting chemical that came up positive: Cyanide. Cyanide is a rapidly acting, potentially deadly chemical that can exist in various forms. It can be a colorless gas, such as hydrogen cyanide (HCN) or cyanogen chloride (CNCl). It is also commonly found in a crystal (powdered granules) form such as sodium cyanide (NaCN), or potassium cyanide (KCN). Cyanide sometimes is described as having a “bitter almond” smell, but it does not always give off an odor, and not everyone can detect this odor so that is not a useful indicator of whether or not cyanide is present.

Where cyanide is found and how it is used Hydrogen cyanide, under the name Zyklon B, was used as a genocidal agent by the Germans in World War II and reports have indicated that 247


during the Iran-Iraq War in the 1980s, hydrogen cyanide gas may have been used along with other chemical agents to kill thousands of people in the Kurdish city of Halabja in northern Iraq. Cyanide is released from natural substances in some foods and in certain plants such as cassava, is contained in cigarette smoke, and the combustion products of synthetic materials such as plastics. In manufacturing, cyanide is used to make paper, textiles, and plastics. It is present in the chemicals used to develop photographs and cyanide salts are used in metallurgy for electroplating, metal cleaning, and removing gold from its ore. Cyanide gas is used to exterminate pests and vermin in ships and buildings. How you could be exposed to cyanide You could be exposed to cyanide by breathing air, drinking water, eating food, or touching soil that contains cyanide. Cyanide enters water, soil, or air as a result of both natural processes and industrial activities. In air, cyanide is present mainly as gaseous hydrogen cyanide. Smoking cigarettes is probably one of the major sources of cyanide exposure for people who do not work in cyanide-related industries. Some first responders to calls pertaining to victims of cyanide poisoning have been exposed through mouth to mouth resuscitation. Because the most common way people are poisoned is through food or drink, it is almost impossible for some of the chemical to not stay on the lips or surrounding areas.

248


How cyanide works The extent of poisoning caused by cyanide depends on the amount of cyanide a person is exposed to, the route of exposure, and the length of time that a person is exposed. Breathing cyanide gas causes the most harm, but ingesting (swallowing) cyanide can be toxic as well. Cyanide gas is most dangerous in enclosed places where the gas will be trapped. Normally the gas will evaporate and disperse quickly in open spaces, making it less harmful outdoors. The gas will also rise because it is less dense than air. Cyanide prevents the cells of the body from using oxygen. When this happens, the cells die. It is more harmful to the heart and brain than to other organs because the heart and brain require a constant source of oxygen. Immediate signs and symptoms of exposure to cyanide: People exposed to a small amount of cyanide by breathing it, absorbing it through their skin, or eating foods that contain it may have some or all of the following symptoms within minutes: • Rapid breathing • Restlessness • Dizziness • Weakness • Headache • Nausea and vomiting • Rapid heart rate Exposure to a large amount of cyanide by any route may cause these other health effects as well: • Convulsions • Low blood pressure • Slow heart rate 249


• Loss of consciousness • Lung injury • Respiratory failure leading to death A laboratory test is required to confirm that a person has been the victim of cyanide poisoning as there are no specific biological clues upon autopsy. Interpretations of blood cyanide concentrations Range (mg/L Less than or equal to .25 0.25 - 2 2-3 Greater than 3

Effect Normal Potentially Toxic Potentially Fatal Fatal

What does the toxicology report say Miss Sally’s Cyanide level was and what can you assume from this number?

How might Miss Sally have been exposed to such a large sample of Cyanide?

250


On a hunch one of the investigators sent the half eaten donut to the toxicology lab and asked his buddy to run a cyanide test. It turns out there was A LOT of cyanide on that donut and it is most certainly the way in which Miss Sally was poisoned.

Look over all your evidence and make a prediction of who the murderer is. Give at least three reasons why you think this person is the murder.

251


252


Unit Nineteen – The Legal System and Expert Testimony

253


254


Unit Nineteen – The Legal System and Expert Testimony The presumption of innocence is an important part of the US legal system. This legal system relies heavily on the confidence level of the people who support it and abide by it. This confidence level is compromised when guilty people go free, but more substantially, when innocent people are convicted. There is no more grave injustice than the freedom of an innocent person being taken away due to presumed guilt by the legal system. This system is not designed to let the guilty go free, but rather to over-protect the rights of the innocent. The United States provides for the presumption of innocence via the 5th, 6th, and 14th amendments as well as precedent case law, Coffin vs. the United States. The 5th amendment states:

“No person shall be held to answer for a capital, or otherwise infamous crime, unless on presentment or indictment of a Grand Jury, except in cases arising in the land or naval forces, or in the Militia, when in actual service in time of War or public danger; nor shall any person be subject for the same offense to be twice put in jeopardy of life or limb; nor shall be compelled in any criminal case to be a witness against himself, nor be deprived of life, liberty, or property, without due process of law; nor shall private property be taken for public use, without just compensation” (1)

255


The 6th amendment states:

“In all criminal prosecutions, the accused shall enjoy the right to a speedy and public trial, by an impartial jury of the state and district wherein the crime shall have been committed, which district shall have been previously ascertained by law, and to be informed of the nature and cause of the accusation; to be confronted with the witnesses against him; to have compulsory process for obtaining witnesses in his favor, and to have the assistance of counsel for his defense.” (1) The 14th amendment states:

“Section 1. All persons born or naturalized in the United States, and subject to the jurisdiction thereof, are citizens of the United States and of the state wherein they reside. No state shall make or enforce any law which shall abridge the privileges or immunities of citizens of the United States; nor shall any state deprive any person of life, liberty, or property, without due process of law; nor deny to any person within its jurisdiction the equal protection of the laws.” (2) In addition Coffin vs. The United States (1895) firmly established the presumption of innocence, and which in part states:

“The principle that there is a presumption of innocence in favor of the accused is the undoubted law, axiomatic and elementary, and its enforcement lies at the foundation of the administration of our criminal law.”(3)

Other countries and/or unions around the world have included presumption of innocence in their own case law, declarations, or historical documents. 256


There are two kinds of witnesses that can be called in a criminal trial; the factual witness and the expert witness. A factual witness can only testify to matters of which they have direct personal knowledge like I arrived at the scene at 5:45 AM. I saw the victim lying on the couch and she was not breathing. I saw clear liquid on the floor in front of the door. The factual witness cannot say I think that liquid was water or it looked like she fell onto the couch instead of lying down on it, unless they have been accepted as an expert witness. An expert witness then, is very special in the eyes of the court because they are allowed to give opinions. If a detective is giving testimony he or she can say: The position of the body indicated an unnatural pose and it is possible that she collapsed on to the couch. Often times an expert is called in to legal proceedings in order to evaluate scientific evidence. They will be expected to provide opinions on the significance of scientific findings regardless of whether the information influences a guilty or not guilty verdict. An expert witness must always remain objective and will be expected to defend the analytical process of all laboratory techniques used. They should also be willing and forthright about any shortcomings the technique has because they may decrease the significance of a test. An expert witness is only as good as his or her credentials and are often only useful for very specific portions of the case in which they are considered an “expert’ in their field. In addition, if any bias is sensed by the jury the expert can lose credibility.

257


Bias is when your opinions overrun the facts of the case. For example, if the detective said: This was a drug related death because the neighborhood is filled with drug dealers, even when the toxicology report came back negative for drugs, this would be bias. Another way bias can be introduced is by a conflict of interest (the expert has some relation to one or more parties on the case) or personal feelings. In addition, the expert must never answer a question that is outside his or her specialty area. If a question is asked that has no bearing on their area of expertise, they must say they are not qualified to answer that question. It is important to remember that an expert can be called for both the prosecution and the defense. Many people think of the expert witness as someone who works for the government, but that isn’t true. Any qualified person can be an expert in their field. Regardless of which side of the courtroom the expert is helping, they must always remember that their job is to tell the truth as they see it, not to bolster the case of either side. The scientific expert witness should not let the opposing lawyer make them feel uncomfortable. Lawyers are well educated and smart, but they are not scientists and are generally unable to trip up an expert unless the line of questioning is out of the scientist’s area of expertise, or the scientist is lying or manipulating the truth. When speaking to the courtroom, the expert witness should realize that everyone has a role to play and often those roles will not always coincide with justice. 258


For example: The judge is busy. He or she would like the trial to move along quickly and efficiently. The expert witness should not waste the judge’s time with unimportant details. The jury was picked for reason and if a scientific expert is on the stand, the reason they were picked is because they know nothing about science. They will be bored easily if the expert speaks in technical language. The defense lawyer’s only role is to make his client look innocent. The prosecutor’s only role is to make the defendant look guilty. The expert witness must always remember that his or her only role is to tell the truth as they know it. An additional note about statistics in the courtroom: Statistics is the art (and science) of presenting data and numbers so that it either reflects or distorts the truth. It is just as easy to make statistics say something false as it is to make them say something true. Let me give you an example: Meteorologists are scientist who study and predict weather patterns. Currently there is some controversy about a phenomenon called “Global Warming”. This phenomenon uses statistics, numbers, and data obtained from years of temperature recordings to draw conclusions. This data may or may not be true, that isn’t the point of this section on statistics. The point is that before you can make any conclusions, you 259


must know with absolute certainty that your sampling method was consistent and reliable. So with those two parameters; consistence and reliability, I will present the following questions: For how many years were the temperatures recorded? What type of instrument was used for this recording? Where were these recordings taken? With just these three simple questions we can learn a lot about how statistics can be manipulated. For example – if temperature recordings have only been taken for less than 200 years, is that an accurate representation of all daily temperatures from the beginning of earth time to present day? If all recordings were taken with a thermometer, were the same type, brand, and quality of thermometer used for all recordings? Were all recordings repeated each year in exactly the same place? You can see right off the bat that we may have some problems, however if none of these questions are asked, then these problems will never present themselves. In addition, samples can be directly manipulated. If we only took temperature readings in Death Valley, would it appear that the earth was hotter than it really was? If we only took temperature readings in the arctic, would the temperature of the earth appear cooler than it actually was? How you conduct a scientific study or analysis makes a huge difference on the outcome. In addition, your own biased expectations can also manipulate the outcome. If you are expecting the temperatures to go 260


up, it is natural to start looking for a pattern before all the data is in. That is called bias. The same holds true in a courtroom. Numbers and data can be manipulated when a scientist is trying to draw conclusions about a particular phenomenon from a large sample or collection of data. All things must be suspect in a courtroom because a person’s innocence depends on it. The expert in a legal proceeding should look for inconsistencies in testimony and data presented by the opposing lawyer and offer up a counter opinion. At the very least, if they have no counter opinion, they should point out such inconsistencies when given the chance. The take home point about statistics: Don’t ever trust that they PROVE anything unless you or a trusted expert have looked at the study and deemed that it was conducted properly and without bias.

261


262


Exercises for Unit Eighteen All the Evidence Possible suspects: Joe Landlord

Give a reason why the investigators feel that each of these men should be suspects in the murder of Miss Sally:

In order to convince a jury that someone is guilty they must have a motive to commit the crime. Name a possible motive for each of these suspects.

263


The autopsy report for Miss Sally came back inconclusive – are you surprised by this now that you know more? Why or why not?

The police have decided to go ahead and charge Joe for the murder of Miss Sally. Give three reasons why they did this.

Who do YOU think killed Miss Sally? Do you agree with the investigator’s conclusion? Why or why not?

264


Unit Twenty – Solving the Crime

265


266


Unit Twenty – Solving the Crime You have now been through the entire course and have made a final determination about the death of Miss Sally and you have a suspect in mind. Now all you need it the expert opinion of some forensic specialists. During trial both the prosecution and the defense called expert witnesses. The following is the testimony of each side: Prosecution expert: Forensic Psychiatrist Joe was deeply resentful of the continuous rejection by Miss Sally. He decided to kill her instead of face her every day. He ordered the cyanide online and coated a fresh donut with the poisonous powder, then gave her the donut as a gift. Prosecution expert: Criminal Investigator I was suspicious of Joe right away. He was up and about around the same time Miss Sally’s death occurred, 3:15 AM, and was suspiciously absent when her body was found. I believe he planned this poisoning ahead of time and gave her the donut the night before. He then used a key he had stolen earlier in the day to enter her apartment and opened the window to make it look like she froze to death. Defense Expert: Forensic Psychiatrist Utter hogwash! I’ve examined Joe and there is no evidence that he held any resentment what so ever for Miss Sally’s hesitation. In fact, she had already agreed to see him the following weekend, why would he murder her when he had just gotten a date?

267


Defense Expert: Forensic Pathologist It was very difficult to determine the exact time of death due to the cold temperature in the room, but based on all my years of experience I would say that she’d been dead no longer than 3 hours once I got to the scene to check on the body . She most certainly did not die the night before.

Have you changed your mind about the guilty party? If so list your reasons below:

268


Ut Oh! The Defense has called one of the Criminal Investigators as a hostile witness! A hostile witness is a witness that is unlikely to be willing to give testimony about one side or another. This gives the lawyer freedom to ask questions that might not normally be allowed. Transcribed Testimony of the Hostile Witness: Defense Lawyer: Officer Charlie, were you the first to arrive on the scene after the Landlord called 911? Officer Charlie: Yes. Defense Lawyer: And were you the same officer who noticed the blue tinted snow in the Fountain Courtyard that morning? Officer Charlie: Yes. Defense Lawyer: And were you the same officer who noticed clear liquid on the floor inside Miss Sally’s apartment? Officer Charlie: Yes. Defense Lawyer: How do you suppose that clear liquid got on the floor? Officer Charlie: Someone tracked it in from outside. Defense Lawyer: Right – so if Granny Smith saw Joe leaving his apartment for work at 3:45AM and the landlord was already throwing down magnesium chloride, which taints the snow blue, what can you say about the murderer?

269


Officer Charlie: That he entered the apartment before the landlord started shoveling snow? Defense Lawyer: What time did the Landlord say he was outside shoveling? Officer Charlie: 4 AM Defense Lawyer: My client says he saw him at 3:45 AM and Granny Smith said she saw him shoveling before my client left his apartment for work. Officer Charlie: Well, I don’t see why that matters anyhow. It was a poisoning, no one had to be there when she died. Defense Lawyer: Thank you that is all.

The defense has decided to call Joe’s boss at the donut shop next. Defense Lawyer: Mr. Hole, when was the last time your bakery made powered donuts? Mr. Hole: We don’t make powdered donuts. Defense Lawyer: Why not? Mr. Hole: We only make fancy French donuts. Defense Lawyer: Do you recognize this bag? (The defense lawyer holds up the white bakery bag taken from Miss Sally’s apartment). Mr. Hole: Yes, that is the bag of my competitor across the street. 270


Defense Lawyer: Does he make powdered donuts? Mr. Hole: Yes, he makes all kinds of cheap donuts. That guy is good friends with the landlord, sometimes the landlord even goes over there in the middle of the night to chat with him when he’s making dough. In fact, I saw him that night Miss Sally was murdered! He was over there around 2 AM! I know because I had to go in early to start a cake for my nephew’s birthday! The defense rests.

Now you get to be the jury – is Joe guilty? Or did the Landlord commit the murder? Give reasons for your decision.

Guilty:

Not-Guilty:

271


Unless the guilty party confesses, the investigators, jury, judge, and lawyers will never really know the truth. In this case no one confessed. What needs to be determined is if there is enough evidence, beyond a reasonable doubt, that Joe was the murderer. If you found Joe not guilty –do you have enough evidence to bring charges against the Landlord? Forensic science can be a very rewarding career, but unlike TV, the crime is not always solved, nor is the decision made by law enforcement and juries always right. The very last thing I would like for you to do is go to this website: http://www.innocenceproject.org/

Here you will find a lot of information about innocent people who have not only been accused of crimes, but found guilty. This is the biggest travesty of a criminal investigation and sometimes all the parties involved are emotional instead of logical. That is why all expert witnesses and criminal investigators must put their personal feelings aside and only look at the evidence.

272

Forensic Science New Print 2011

Recommend Documents