© 2000 Nature America Inc. • http://neurosci.nature.com
contents volume 3 no 2
february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
http://neurosci.nature.com
Kim and colleagues report a technical advance that gives sufficient spatial resolution to image cortical column organization by fMRI in cats. Instead of the traditional positive BOLD fMRI signal, the authors used an earlier, negative phase of the signal to obtain the map of cortical orientation columns shown (image filtered and rearranged for artistic purposes). See pages 105 and 164.
editorial How experts communicate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
news and views A taste for umami . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 Bernd Lindemann ➤ SEE ARTICLE, PAGE 113
Presynaptic facilitation by hyperpolarization-activated pacemaker channels. . . . 101 Steven A. Siegelbaum ➤ SEE ARTICLE, PAGE 133
Neurodegeneration in the polyglutamine diseases: Act 1, Scene 1 . . . . . . . . . . . 103 Robert Nussbaum and Georg Auburger ➤ SEE ARTICLE, PAGE 157
Expertise recruits face-selective brain areas. Page 191.
Non-invasive visualization of cortical columns by fMRI . . . . . . . . . . . . . . . . . . . . 105 Amiram Grinvald, Hamutal Slovin and Ivo Vanzetta ➤ SEE ARTICLE, PAGE 164
brief communications Rapid, synaptically driven increases in the intrinsic excitability of cerebellar deep nuclear neurons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109 CD Aizenman and DJ Linden
A taste receptor for monosodium glutamate. Pages 99 and 113.
Nature Neuroscience (ISSN 1097-6256) is published monthly by Nature America Inc., headquartered at 345 Park Avenue South, New York, NY 10010-1707. Editorial Office: 345 Park Avenue South, New York, NY 10010. Telephone 212 726 9200, Fax (212) 696 9635. North American Advertising: Nature Neuroscience, 345 Park Avenue South, New York, NY 100101707. Telephone (212) 726-9200. Fax (212) 696-9006. European Advertising: Nature Neuroscience, Porters South, Crinan Street, London N1 9SQ. Telephone (0171) 833 4000. Fax (0171) 843 4596. New subscriptions, renewals, changes of address, back issues, and all customer service questions in North America should be addressed to Nature Neuroscience Subscription Department, PO Box 5054, Brentwood, TN 37024-5054. Telephone (800) 524-0384, Direct Dial (615) 377 3322, Fax (615) 377 0525. Outside North America: Nature Neuroscience, Macmillan Magazines Ltd., Houndsmill, Brunel Road, Basingstoke, RG21 6XS, U.K.. Tel: +44-(0)1256-329242. Fax: +44-(0)1256 812358. Email:
[email protected]. Annual subscription rates: U.S./Canada: U.S. $595, Canada add 7% for GST (institutional/corporate), U.S. $195, Canada add 7% for GST (individual making personal payment BN: 14091 1595 RT); U.K./Europe:£435 (institutional/corporate), £185 (individual making personal payment), £99 (student); Rest of world (excluding Japan): £480 (institutional/corporate), £195 (individual making personal payment), £110 (student); Japan: Contact Japan Publications Trading Co. Ltd., 2-1 Sarugaku-cho 1 chome, Chiyoda-ku, Tokyo 101, Japan, phone (03) 292-3755. Back issues: U.S./Canada, $45, Canada add 7% for GST; Rest of world: surface U.S. $43, air mail U.S. $45. Reprints: Nature Neuroscience Reprints Department, 345 Park Avenue South, New York, NY 10010-1707. Subscription information is available at the Nature Neuroscience homepage at http://neurosci.nature.com. POSTMASTER: Send address changes to Nature Neuroscience Subscription Department, P.O. Box 5054, Brentwood, TN 37024-5054. Application to mail periodicals postage rate is paid at New York, NY. Executive Officers of Nature America Inc: Nicholas Byam Shaw, Chairman of the Board; Jan Velterop, President; Edward Valis, Secretary-Treasurer. Printed by Publishers Press, Shepherdsville, KY, USA. Copyright ©2000 Nature America Inc.
nature neuroscience • volume 3 no 2 • february 2000
i
© 2000 Nature America Inc. • http://neurosci.nature.com
contents
articles A metabotropic glutamate receptor variant functions as a taste receptor . . . . . . 113 N Chaudhari, AM Landin and SD Roper ➤ SEE NEWS AND VIEWS, PAGE 99
Identification and characterization of the high-affinity choline transporter . . . . . 120 T Okuda, T Haga, Y Kanai, H Endou, T Ishihara and I Katsura Receptors with opposing functions are in postsynaptic microdomains under one presynaptic terminal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126 G Tsen, B Williams, P Allaire, YD Zhou, O Ikonomov, I Kondova and MH Jacob
© 2000 Nature America Inc. • http://neurosci.nature.com
Gene regulation in spinocerebellar ataxia type 1. Pages 103 and 157.
Enhancement of synaptic transmission by cyclic AMP modulation of presynaptic Ih channels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133 V Beaumont and RS Zucker ➤ SEE NEWS AND VIEWS, PAGE 101
Synaptic activity modulates presynaptic excitability . . . . . . . . . . . . . . . . . . . . . . 142 TA Nick and AB Ribera A new form of long-term depression in the perirhinal cortex. . . . . . . . . . . . . . . . 150 K Cho, N Kemp, J Noel, JP Aggleton, MW Brown and ZI Bashir Polyglutamine expansion down-regulates specific neuronal genes before pathologic changes in SCA1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157 X Lin, B Antalffy, D Kang, HT Orr and HY Zoghbi ➤ SEE NEWS AND VIEWS, PAGE 103
Psychophysics of Marroquin patterns. Page 170.
High-resolution mapping of iso-orientation columns by fMRI . . . . . . . . . . . . . . . 164 DS Kim, TQ Duong and SG Kim ➤ SEE NEWS AND VIEWS, PAGE 105
Dynamics of perceptual oscillations in form vision . . . . . . . . . . . . . . . . . . . . . . . . 170 HR Wilson, B Krupa and F Wilkinson Motion perception during saccadic eye movements . . . . . . . . . . . . . . . . . . . . . . 177 E Castet and GS Masson Thermosensory activation of insular cortex . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184 AD Craig, K Chen, D Bandy and EM Reiman Inhibition and excitation at the same axon terminal. Page 126.
Expertise for cars and birds recruits brain areas involved in face recognition. . . . 191 I Gauthier, P Skudlarski, JC Gore and AW Anderson
classified advertising see back pages
nature neuroscience • volume 3 no 2 • february 2000
ii
© 2000 Nature America Inc. • http://neurosci.nature.com
editorial
© 2000 Nature America Inc. • http://neurosci.nature.com
How experts communicate In Darwin’s time, it was possible to write a book that was both a primary scientific report and a popular bestseller. Today, however, that seems like a remote ideal1. Not only is it difficult to communicate scientific ideas to the general public, but scientists seem to have increasing difficulty communicating with each other. Even within biology, researchers in different areas of specialization are often unable to understand each other’s papers. This is a particular problem for a field such as neuroscience, whose advances have often depended on the exchange of ideas across disciplines. Nature Neuroscience seeks to encourage clear writing and to make everything we publish accessible to as many readers as possible. Yet even if this seems uncontroversial in principle, it is surprisingly difficult to achieve in practice. Despite the obvious advantages of communicating clearly, scientists are often resistant to the suggestion that their articles should be comprehensible to readers outside their own field. For one thing, there is a tendency to equate plain language with oversimplification. As science becomes more complex, the argument goes, an ever-increasing amount of specialist jargon is required to describe it precisely. Even if this is true, however, technical terminology can be explained, and it need not present an insurmountable problem to the scientifically literate reader. A more important deterrent to clear expression—although people are less willing to admit it—is that plain language, no matter how precise, strikes many scientists as somehow unprofessional. It is often seen as a badge of academic credibility to express short simple ideas in long ponderous phrases; why else would anyone choose to write a sentence such as "To elucidate these issues, we utilized the caprine model" instead of "We studied these questions using goats"? This type of pomposity is easy to avoid once it is recognized, and fortunately many other common problems in scientific writing are similarly easy to correct. One of the most obvious is excessive use of abbreviations. People within the field are likely to be familiar with common abbreviations and process them as if they were words. However, every unfamiliar abbreviation makes an additional demand on the reader’s memory. Individually, such problems are minor nuisances, but as they accumulate, they can severely impair understanding. Another common barrier to communication is to describe experimental results in ways that emphasize the method of analysis rather than the phenomenon being studied. For example, "ANOVA revealed a significant main effect of age and a significant interaction effect" is much less informative than "Protein levels decreased significantly with age, and this decline was more pronounced in adrenalectomized animals." Even when making the effort to write for a wide readership, many authors adopt solutions that are ineffective. For example, nature neuroscience • volume 3 no 2 • february 2000
vapid introductory statements like "Much recent research has been aimed at understanding synaptic plasticity" are as useless to nonspecialists as they are to anyone else. Concluding paragraphs present a similar temptation to vagueness; saying "this work provides insights" into some problem is less informative than explaining what those insights were. In fact, there is nothing mysterious about writing for nonspecialists. The key is to examine each sentence for hidden assumptions and unfamiliar concepts, and to ensure that they are clearly explained in a way that minimizes the demands on the reader’s memory. The problems posed by a poorly written article are greater for nonspecialists, but even experts comprehend more easily if they do not have to waste mental resources on parsing difficult sentences. Research in linguistics and cognitive psychology shows that sentence structure creates expectations about content and emphasis. Writing that violates these expectations is difficult to read 2. Clear writing reduces the demands on working memory by presenting information where readers expect to find it. Unfortunately, scientific writing often does the opposite. One common mistake is to separate the sentence’s subject from its verb with a long clause that contains important information (for example, "An increase in mRNA, which resulted from transcriptional upregulation by factors binding to the AP1 site, was observed"). Because the reader is distracted by the need for syntactic closure, material between subject and verb receives less attention than it should. The opposite problem occurs when unimportant material is placed in a location that readers naturally emphasize. Each sentence contains at least one ‘stress position’ near the end, at the point when readers comprehend how the various parts of the sentence relate to each other. Indeed, behavioral studies indicate that readers slow down as they reach the end of a sentence or clause3. Material at this location is perceived as being important—whether the author intended it to be or not. Thus, readers are most comfortable when familiar information at the beginning of the sentence creates a context for important new information introduced at the end. These rules do not require writers to avoid complicated ideas or long sentences, only to construct them carefully. Because young scientists learn by imitating their elders, a culture of bad writing tends to be self-perpetuating. Perhaps the solution is for graduate programs to place more emphasis on formal instruction in scientific writing, but this will only happen if scientists appreciate the need for better communication and understand the steps that can be taken to achieve it. 1 2 3
Gould, S. J. Science 286, 899 (1999). Gopen, G. D. & Swan, J. A. Am. Scientist 78, 550–558 (1990). Just, M. A. & Carpenter, P. A. Psych. Rev. 87, 329–354 (1980).
97
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
A taste for umami Bernd Lindemann
© 2000 Nature America Inc. • http://neurosci.nature.com
Chaudhari and colleagues identify the taste receptor for L-glutamate, also known as umami, found in protein-rich foods. The protein they describe is a new G-protein-coupled receptor that corresponds to a truncated form of the metabotropic glutamate receptor mGluR4. Molecular biologist have been trying for ity of taste receptor cells directly, either by downregulating the second messenger many years to clone taste receptors and contributing to current flow through ion cAMP. This receptor is expressed on identify their ligands. Now at last, they channels or by modulating channel conpresynaptic terminals of both glutaseem to have succeeded. Chaudhari and ductances4. In contrast, sweet, bitter and matergic and GABAergic neurons, where colleagues have identified a receptor for it mediates glutamate-dependent reguumami are all thought to depend on the umami, the taste corresponding to L-glulation of neurotransmitter release7. In activation of G-protein-coupled receptors tamate1. The umami receptor is a G-pro(GPCRs), but until now, none of these addition, mGluR4 is expressed in taste receptors has been definitively identified. tissue, making it an obvious candidate tein-coupled receptor, which binds for the umami receptor. Howevextracellular glutamate and signals er, one problem with this idea is through a G protein to regulate the that glutamate activates mGluR4 level of intracellular cAMP and the at micromolar concentrations, firing of taste receptor cells. far below the taste threshold. Until recently, the textbook wisChaudhari and colleagues dom was that humans could detect have now resolved this puzzle by four primary tastes: sweet, bitter, showing that rat taste tissue also salty and sour. Yet as early as 1908, expresses an alternative tranKikunae Ikeda at the Tokyo Imperiscript of mGluR4 (which may al University had identified L-glutaarise by differential transcription mate as the principal source of a fifth and/or splicing), in which the taste. This taste quality, which canfirst 300 amino acids of the not be mimicked by any combinaamino (N) terminus are absent. tion of the other four tastes, Ikeda They go on to show that this isocalled ‘umami’. Taste researchers have form, when expressed in a cullong been aware of Ikeda’s work, but tured cell line, can transduce a it is only recently that umami has response to extracellular glutagained widespread recognition in the mate, over a concentration range West, perhaps in part because of the that is consistent with it being increasing popularity of oriental the umami taste receptor. food 2. Monosodium glutamate The loss of the N terminus (MSG), of course, is widely used as would be predicted to decrease a flavoring additive in Asian cuisine, the receptor’s affinity for glutabut the most abundant amino acid, mate. The sequence of mGluR4 is glutamate, is also an important Image courtesy of Umami Information Center, Tokyo homologous to that of bacterial nutrient, and it is presumably for this reason that some animals have Fig. 1. Umami is an important flavor constituent of many amino-acid binding proteins, for which crystal structures are availevolved the ability to taste it. Free protein-rich foods. able. Based on this homology, the glutamate is found in many proteinN terminus of mGluR4 is predicted to A report last year described two new rich foods, including meat, milk and form a ‘clamshell’ structure, in which the GPCRs, TR1 and TR2, that are expressed seafood (Fig. 1); it is particularly concentwo halves of the shell are connected by a in taste buds. They were suggested to be trated in aged cheese. Rats and humans can hinge, forming a cleft in which glutamate candidates for sweet and bitter receptors, both recognize the taste of glutamate, and can bind 8–10 (Fig. 2). The high-affinity but at present there is no functional evifor adult humans the detection threshold 5,6 dence for this proposal . is about 0.7 mM (ref. 3). binding site has been mapped by siteThe key to further advance in underdirected mutagenesis of the mGluR4 Chaudhari and colleagues1 have prostanding taste perception will be the idensequence, with the hydroxyl groups of Ser vided such evidence for what seems to tification of taste receptors. Salty and sour 159 and Thr 182 predicted to form be the umami receptor. The molecule tastes are produced by small cations such hydrogen bonds with glutamate (or its they describe is a new GPCR that correas Na+, K+ and H+, which affect the activagonists) and Arg 78 to provide electrosponds to a truncated form of the static attraction. These highly conserved metabotropic glutamate receptor residues lie within the first half of the mGluR4, which they term ‘tasteBernd Lindemann is in the Department of shell structure, and mutating any of them mGluR4’. The mGluR4 receptor was Physiology, Bldg 58, Saar University, D-66421 to alanine causes a major (over 95%) originally described in the brain, where Homburg, Germany. e-mail:
[email protected] reduction in glutamate binding10. it responds to extracellular glutamate by nature neuroscience • volume 3 no 2 • february 2000
99
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
A skeptic might still argue that taste-mGluR4 is not a taste receptor but is instead involved in synaptic transmission or some other function of taste tissue, but several further lines of evidence are consistent with a role in taste transduction. First, the authors confirm that taste-mGluR4 is activated by the glutamate agonist LAP4, which to rats is indistinguishable from glutamate Fig. 2. The mGluR4 protein is a seven-transmembrane itself11. As with glutamate, the receptor, and the N terminus of the brain isoform (center) concentrations of L-AP4 required forms a 'clamshell' structure, homologous to bacterial to produce a cAMP response are amino-acid-binding proteins (left), which contains the highaffinity binding site for glutamate. The taste isoform (right) consistent with the known taste thresholds in rats. Second, the is truncated at the N terminus. same group has previously shown by in situ hybridization that mGluR4 expression in taste tissue is concentrated in the taste buds Given the importance of these N-terthemselves, and that about 40% of buds are minal residues, which are absent in the positive for the label. Although the probe taste isoform, how can the truncated taste used in that study did not distinguish variant of mGluR4 recognize glutamate between the two isoforms, which may both at all? Presumably it must contain an be present in taste tissue, it is significant additional binding site, of lower affinity that neither isoform was detected outside than the one at the N terminus. It is the taste buds, either by in situ hybridizaunclear whether a similar site exists in the tion or by RT-PCR assays11. brain isoform, but it is interesting to note that one of the bacterial amino-acidFinally, the effect of mGluR4 activation binding proteins was proposed to contain in cultured cells is to decrease cAMP leva second binding site on the opposite side els, and glutamate is known to reduce of the cleft from the first site8. It remains cAMP in isolated taste buds (X. Zhou & N. Chaudhari, Chem. Senses 22, 834, 1997). to be determined whether glutamate Although the experiments on taste buds binds to the taste mGluR4 isoform at the were performed under somewhat artificial corresponding site or at some other posiconditions—the baseline concentration of tion, either in the extracellular domains cAMP was raised by treatment with or in the bundle of seven helices that span forskolin—they nevertheless seem to reflect the membrane. the normal process of taste transduction. By expressing the two isoforms in a For instance, the effect of glutamate was cultured cell line, Chaudhari and colenhanced by inositol monophosphate, leagues1 show that activation of the taste which, like other ribonucleotides that are isoform (as measured by the reduction in found in meat and other umami foods, intracellular cAMP) requires a much enhances the taste of glutamate2–4. higher concentration of glutamate than does the brain isoform. This was not due How does the decrease in cAMP to any difference in the level of expression modulate membrane potential and cause of the two isoforms on the cell surface, so the taste receptor cell to signal the presit seems likely to reflect a reduced affinience of ligand? Electrophysiological ty for glutamate. This would be consisrecordings of isolated taste cells from the tent with the truncation of the presumed posterior part of the tongue have shown high-affinity binding site, but it will be two types of responses to L-glutamate12. important to confirm the difference in Most cells (60%) respond with a susaffinities by direct binding measurements. tained hyperpolarization, possibly due to Certainly, it would make sense for the closure of nonselective cation channels. umami receptor to have a lower affinity, A few cells (4%) respond with a transient given the high concentrations of glutadepolarization, probably due to the mate that exist in certain foods. The conopening of such channels. centrations required to activate the It seems likely that the sustained receptor are also in the same range as the hyperpolarizing response is what leads to known behavioral detection threshold taste signaling, because L-AP4, an ago(about 100 micromolar in juvenile and 1 nist that also evokes the taste of umami, mM in adult rodents). also caused the sustained response but 100
not the transient depolarization. This suggests a model in which glutamate triggers a decrease in cAMP, resulting in the closure of cyclic nucleotide-gated channels13 and hyperpolarization of taste receptor cells. This would be analogous to visual transduction, in which photons trigger the breakdown of cGMP, resulting in closure of cGMP-gated cation channels and hyperpolarization of photoreceptors. In the case of taste receptors, it is still not known whether hyperpolarization modulates tonic release of transmitter, as it does in vertebrate photoreceptors, or whether it has some other effect such as inhibiting the response to other tastants. An additional point of interest is that a small number of taste cells from the anterior part of the rat tongue have been found to respond to L-AP4 with a depolarization rather than a hyperpolarization14. The basis for this difference is unknown; perhaps they express channels that are closed rather than opened by cAMP15. The role of these cells in taste transduction is also unknown, but it is possible that they, rather than the hyperpolarizing cells, may be the real umami receptors. Even though it cannot clarify all these issues, the paper by Chaudhari and colleagues is an important advance. The cloning of a taste receptor with an identified ligand should add meat to the field of taste research. Bon appétit! 1. Chaudhari, N., Landin, A. M. & Roper, S. D. Nat. Neurosci. 3, 113–119 (2000). 2. Umami Company Report. Umami Information Center, 1-15-1 Kyobashi, Chuoku, Tokyo 104, Japan (1985). 3. Yamaguchi, S. Physiol. Behav. 49, 833–841 (1991). 4. Lindemann, B. Physiol. Rev. 76, 719–766 (1996). 5. Hoon, M. A. et al. Cell 96, 541–551 (1999). 6. Lindemann, B. Nat. Med. 5, 381–382 (1999). 7. Bradley, S. R. et al. J. Comp. Neurol. 407, 33–46 (1999). 8. Sack, J. S., Saper, M. A. & Quiocho, F. A. J. Mol. Biol. 206, 171–191 (1989). 9. O’Hara, P. J. et al. Neuron 11, 41–52 (1993). 10. Hampson, D. R. et al. J. Biol. Chem. 274, 33488–33495 (1999). 11. Chaudhari, N. et al. J. Neurosci. 16, 3817–3826 (1996). 12. Bigiani, A., Delay, R. J., Chaudhari, N., Kinnamon, S. C. & Roper, S. D. J. Neurophysiol. 77, 3048–3059 (1997). 13. Misaka, T. et al. J. Biol. Chem. 272, 22623–22629 (1997). 14. Lin, W. & Kinnamon, S. C. J. Neurophysiol. 82, 2061–2069 (1999). 15. Kolesnikov, S. S. & Margolskee, R. F. Nature 376, 85–88 (1995).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
Presynaptic facilitation by hyperpolarization-activated pacemaker channels Steven A. Siegelbaum
© 2000 Nature America Inc. • http://neurosci.nature.com
Hyperpolarization-activated potassium channels presynaptically facilitate transmitter release in a calcium-independent fashion. The past few years have seen rapid advances in our understanding and appreciation of hyperpolarization-activated nonselective cation channels, also known as Ih channels. Although the first well-characterized role of these channels was the control of pacemaking activity in sinoatrial node cells of the heart1, they are also widely expressed in peripheral and central neurons 2. Neuronal I h channels control rhythmic electrical activity in spontaneously active cells and regulate membrane excitability in quiescent cells. On page 133 of this issue, Beaumont and Zucker3 report a new role for Ih channels—they contribute to presynaptic facilitation of transmitter release. Surprisingly, this facilitation does not seem to involve an increase in intracellular calcium; instead, the authors raise the provocative possibility that it may involve a direct coupling between these channels and the vesicular release machinery. Ih channels have several distinctive features. Unlike most voltage-gated channels, they open in response to negative-going voltage steps to potentials within the range of the normal resting potential (Fig. 1b). They conduct both potassium (K+) and sodium (Na+) ions, with a three-fold greater permeability to K +, yielding a reversal potential of –30 to –40 mV under physiological conditions. As a result, the opening of Ih channels near the resting potential (~ –60 mV) generates an inward, depolarizing current that is largely carried by Na+. In heart pacemaker cells, these channels contribute to the slow phase of depolarization that follows the repolarization phase of the action potential. As the membrane potential reaches threshold, voltage-gated Na+ channels and T-type Ca2+ channels are activated, generating the rapid rising phase of the next action potential, during which the Ih channels shut (Fig. 1c). Another Steven Siegelbaum is at the Center for Neurobiology, Department of Pharmacology, Howard Hughes Medical Institute, Columbia University, 722 W. 168 St., New York, New York 10032, USA. e-mail:
[email protected]
unusual property of these channels is their regulation by cyclic nucleotides1, which speed the rate of channel activation by binding to an intracellular site on the channel (Fig. 1b). In the heart, this speeds the slow phase of spontaneous depolarization (and hence the heart rate) in response to β-adrenergic receptor stimulation. The genes encoding Ih channels were recently cloned from both mammals4–6 and sea urchins7 (see ref. 8 for review). These genes, called HCN1–4 in mammals, are members of the voltage-gated K+ channel family. The encoded proteins contain six transmembrane segments, including a positively charged S4 voltage sensor (Fig. 1a) and a pore-forming P region that includes
a
b
P
out
the K + channel signature sequence (gly–tyr–gly). In addition, the intracellular C terminus contains a 120-amino-acid sequence that is homologous to the cAMPand cGMP-binding domains of other proteins, and is thus the likely site for cAMP regulation of channel opening8. All four mammalian genes are expressed in brain, with differing expression patterns. In neurons, Ih channels have diverse functions. They were initially shown to be inward rectifiers; they are active near the resting potential and pass inward current more readily than outward current, thereby helping to control resting potential and input resistance2. In photoreceptors, Ih channels help to damp the hyperpolarizing effect of light; they are activated by hyperpolarization, causing the voltage response to light to fade during the first 100–200 ms, thus producing sensory adaptation. In many CNS neurons, activation of Ih channels following inhibitory postsynaptic potentials contributes to a rebound afterdepolarization (ADP), which can trigger an action potential. Ih can also contribute to spontaneous activity in neurons, similar to its role in the heart. For instance, in thalamocortical relay neurons, activation of Ih underlies a burst firing pattern associated with slow-
-50 mV s1
s2
s3
s4
s5
s6
in
-90 mV CNBD
N
Control +cAMP
C
d
50 Hz control prox
c
dist
+cAMP +40 mV
Control 10 mV +ZD7288
50 ms dist prox
-60 mV Ih
ICa,T
Amy Center
Fig. 1. Ih channels and their role in excitability. (a) Schematic of transmembrane topology of the HCN hyperpolarization-activated channels. (b) Hyperpolarizing voltage step from –50 mV to –90 mV activates an inward Ih current with slow kinetics. On returning to the holding potential, there is an inward tail current as the Ih channels deactivate. Activation of Ih under basal conditions (blue) and after elevation of cAMP (red). (c) Contribution of Ih current to spontaneous action potential generation under basal conditions (blue) and after elevation of cAMP (red). (d) Role of Ih in dendritic integration. EPSPs recorded in cell body of hippocampal CA1 pyramidal neuron in response to stimulation of distal or proximal Schaffer collateral inputs. Top traces, control. Bottom traces, after blockade of Ih with ZD7288 (from ref. 9). Ih channels, localized at a high density in the distal dendrite, normally act to speed the rate of decay of distal EPSPS, perhaps by decreasing the local membrane time constant. On blockade of Ih channels, there is a preferential slowing of the decay phase of the distal EPSP, which increases temporal summation.
nature neuroscience • volume 3 no 2 • february 2000
101
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
wave sleep. Regulation of Ih in these cells by cAMP is important in the sleep–wake cycle2. Ih channels are also expressed in dendrites, where they influence the cable properties of the dendrite and shape the time course of the EPSP as it is propagated to the soma9 (Fig. 1d). In their new study, Beaumont and Zucker3 extend the role of Ih in neurons by showing that these channels can alter neurotransmitter release from presynaptic terminals. Recording from the motor terminals at crayfish neuromuscular synapses, the authors demonstrate a pronounced ADP following a hyperpolarizing voltage step, a hallmark of Ih activation. To confirm that the ADP is indeed due to Ih, the authors show that it is blocked by inorganic and organic blockers of Ih. The presence of Ih channels at these terminals is not particularly surpris-
ing, given that they have been detected electrophysiologically in the large presynaptic terminals of the chick giant calyx10 and by antibody staining on the basket cell terminals surrounding cerebellar Purkinje neuron soma4 (Fig. 2a). What is new about the present study is their proposed function and the unusual mechanism by which these channels regulate synaptic transmission. Previous studies on the crayfish neuromuscular junction have shown that the neurotransmitter serotonin (5-HT), acting through both cAMP and phosphatidyl– inositol second-messenger pathways, causes a facilitation of glutamate release from excitatory presynaptic terminals11. Beaumont and Zucker now show that the effect of 5-HT depends, at least in part, on the direct activation of presynaptic Ih by cAMP. Application of 5-HT, or direct elevation of cAMP by forskolin, depolarizes the presynaptic terminal by 5–10 mV and enhances the magnitude of the postsynaptic response by potentiating transmitter release. Although cAMP often works by activating protein kinase A (PKA), its effect at these terminals could not be attributed to PKA, suggesting that cAMP may instead activate some other target protein by a direct mechanism. Because Ih is activated directly by cAMP, it was a plausible candidate, and the authors confirmed its role by showing that pharmacological agents that inhibit Ih partially block the ability of 5-HT or forskolin to depolarize the presynaptic terminal and enhance transmitter release. How might activation of Ih facilitate release? One possibility is that it could enhance Ca2+ influx into the presynaptic terminal, for example by causing depolarization and Bob Crimi thus opening voltage-gated 2+ Fig. 2. Models for presynaptic facilitation (a, b) Presynaptic Ca channels or by increasing the rate of presynaptic action terminal without (a) and with (b) 5-HT, showing different modes of regulation of transmitter release during cAMP- potential firing. There is a dependent presynaptic facilitation. Closure of K+ channels in precedent for this in the molAplysia neurons, via phosphorylation by protein kinase A, lusk Aplysia, where 5-HT (actbroadens the action potential and increases Ca2+ influx ing through PKA- and through voltage-gated calcium channels, which enhances PKC-dependent pathways) release. There is also a more direct effect of protein kinase A enhances transmitter release phosphorylation on the release machinery. At the crayfish at a sensorimotor synapse by neuromuscular junction presynaptic terminals, 5-HT acts in a + 2+ Ca -independent manner to enhance the pool of readily closing presynaptic K chanreleasable synaptic vesicles. Modulation of Ih contributes to nels, thereby prolonging the this effect by an unknown mechanism that does not involve presynaptic action potential and enhancing Ca2+ influx12 enhanced Ca2+ influx. 102
(Fig. 2b). However, a previous study from the Zucker lab using Ca2+ indicator dyes failed to detect any increases in Ca2+ levels in response to 5-HT at crayfish presynaptic terminals13. Instead, measurements of synaptic vesicle cycling with the membrane dye FM1-43 from the same group14 showed that 5-HT increases the pool of readily releasable vesicles. To explain their findings, Beaumont and Zucker suggest a provocative hypothesis in which opening of Ih channels enhances the mobilization of synaptic vesicles to a readily releasable pool (Fig. 2). The authors suggest that this effect could be due to a direct interaction of Ih channels with the release machinery, perhaps mediated by the cytoskeleton. This idea is not without precedent, in that voltage-gated calcium channels interact directly with the presynaptic SNARE protein syntaxin, regulating both channel function and vesicle fusion15. Alternatively, increased influx of Na+ through activated Ih channels could influence some local signaling cascade. Whatever the mechanism, it seems to involve the stable activation of some downstream signal; the authors show that direct activation of Ih (by a oneminute hyperpolarization of the presynaptic axon) is sufficient to induce an enhancement of transmitter release that persists for as long as 20 minutes. Although further work is needed to pin down this mechanism, the new findings clearly point to an unforeseen role for Ih in the control of neuronal function. 1. DiFrancesco, D. Annu. Rev. Physiol. 55, 455–472 (1993). 2. Pape, H. C. Annu. Rev. Physiol. 58, 299–327 (1996). 3. Beaumont, V. & Zucker, R. S. Nat. Neurosci. 3, 133–141 (2000). 4. Santoro, B., Grant, S. G., Bartsch, D. & Kandel, E. R. Proc. Natl. Acad. Sci. USA 94, 14815–14820 (1997). 5. Santoro, B. et al. Cell 93, 717–729 (1998). 6. Ludwig, A., Zong, X., Jeglitsch, M., Hofmann, F. & Biel, M. Nature 393, 587–591 (1998). 7. Gauss, R., Seifert, R. & Kaupp, U. B. Nature 393, 583–587 (1998). 8. Santoro, B. & Tibbs, G. R. Ann. NY Acad. Sci. 868, 741–764 (1999). 9. Magee, J. C. Nat. Neurosci. 2, 508–514 (1999). 10. Fletcher, G. H. & Chiappinelli, V. A. Brain Res. 575, 103–112 (1992). 11. Dixon, D. & Atwood, H. L. J. Neurophysiol. 62, 1251–1259 (1989). 12. Byrne, J. H. & Kandel, E. R. J. Neurosci. 16, 425–435 (1996). 13. Delaney, K., Tank, D. W. & Zucker, R. S. J. Neurosci. 11, 2631–2643 (1991). 14. Wang, C. & Zucker, R. S. Neuron 21, 155–167 (1998). 15. Catterall, W. A. Ann. NY Acad. Sci. 868, 144–159 (1999).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
Neurodegeneration in the polyglutamine diseases: Act 1, Scene 1 Robert Nussbaum and Georg Auburger
© 2000 Nature America Inc. • http://neurosci.nature.com
A mouse model of the neurodegenerative disease spinocerebellar ataxia type 1 reveals that changes in gene expression begin many weeks before the onset of symptoms. The best therapy for neurodegenerative diseases is likely to be prevention, given the limited regenerative capacity of central nervous tissue. To design rational approaches for the prevention of these diseases, therefore, we need to identify the initial pathological events and understand how they ultimately lead to neuronal cell death. In this issue of Nature Neuroscience, Lin et al.1 provide an enticing glimpse of the first cellular changes in the hereditary neurodegenerative disease spinocerebellar ataxia type 1 (SCA1). They have used a mouse model to identify genes whose expression is altered in the earliest stages of the disease; moreover, their preliminary results suggest that many of these genes show similar alterations in human SCA1 patients. SCA1 is one of eight hereditary neuropathies (the best-known being Huntington’s disease) that are caused by the pathological expansion of a trinucleotide repeat that encodes polyglutamine2. The unraveling of the mechanism underlying these disorders has been one of the great success stories of the last decade. Although each of the diseases involves a different gene and different clinical and neuropathological features, the underlying mechanism is the same in each case; a piece of DNA consisting of CAG repeats becomes amplified, leading to a protein product that contains a pathologically expanded string of glutamine residues. These disorders are relatively rare compared to (say) Alzheimer’s or Parkinson’s disease, but their significance goes beyond their impact on public health. Because they arise from wellThe authors are at the National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, Bethesda, Maryland 20892, USA. email:
[email protected] or
[email protected]
defined genetic causes that lead reproducibly to a common endpoint—death of neurons by apoptosis—the polyglutamine disorders provide a powerful model in which to study the pathogenesis of neurodegeneration. SCA1 is characterized by the onset (usually in adulthood) of cerebellar and bulbar dysfunction. This is due to a severe loss of cerebellar Purkinje cells as well as atrophy and degeneration in various other regions of the brain and spinal cord. The disease has been studied over a number of years, notably in the laboratories of Huda Zoghbi and Harry Orr, who in 1993 identified ataxin-1 as the gene carrying the pathological polyglutamine expansion 3. Although the wildtype ataxin-1 protein has no known function, the mutant form gives rise to aggregates that accumulate in the nuclei of affected neurons. Perhaps surprisingly, ataxin-1 expression is not confined to the cells that die in the disease, but is ubiquitous in both the nervous system and other tissues. Thus, the expression pattern alone cannot explain the characteristic neuronal degeneration observed in SCA1. Zoghbi, Orr and colleagues went on to develop transgenic mouse models for SCA1, using a Purkinje-cell specific promoter to drive the expression of various forms of mutant ataxin-1, and created mice with cerebellar degeneration similar to that found in human patients. By expressing mutant ataxin-1 that lacked either a nuclear localization signal or an aggregation domain, the authors were able to show that nuclear localization of abnormal ataxin-1, and not aggregation per se, was sufficient to cause the phenotype4. In the new paper 1 by Lin et al., the same groups continue their analysis of transgenic mouse models for SCA1 to identify the earliest changes in gene expression in the cerebellum. By using a PCR-based subtractive hybridization
nature neuroscience • volume 3 no 2 • february 2000
approach, they were able to identify transcripts that are either upregulated or downregulated in the mutant mice. The authors identified seven such genes, and for each one they determined when in development expression first begins to differ between mutant and wild-type mice. Surprisingly, one transcript was found to be downregulated on postnatal day 11, only one day after the Purkinjecell specific promoter begins to drive expression of the ataxin-1 transgene, and at least 5–6 weeks before the first manifestations of the disease. This transcript encodes prenylcysteine carboxylmethyltransferase (PCCMT), an enzyme enriched in the endoplasmic reticulum (ER) of the cerebellum, which participates in post-translational lipid modification of many proteins, including the G protein RAS. Later on, but still 2–3 weeks before the onset of clinical signs or Purkinje cell pathology, transcripts encoding proteins with effects on cellular calcium and glutamate metabolism were also downregulated. These included the type I ER inositol triphosphate receptor IP3R1, inositol polyphosphate 5-phosphatase (INPP5A), an ER calcium pump (SERCA2), the calcium ion channel TRP3 and the glutamate transporter EAAT4, which is located in dendritic spines of Purkinje cells. Only later, when pathological and clinical signs first started to appear, did another gene begin to be upregulated; that gene was the earlystage acute phase protein and AD aggregation marker alpha1-antichymotrypsin. Importantly, these changes (apart from the upregulation of alpha1-antichymotrypsin) were only seen in mice expressing the expanded ataxin-1 in the nucleus; no change was seen in control mice expressing either wild-type ataxin-1 or an expanded ataxin-1 that lacked a nuclear localization domain and was confined to the cytoplasm. What about human SCA1 patients? Although it is difficult to obtain material for RNA studies, the authors were able to confirm by immunohistochemistry that three of the gene products downregulated in mutant mice (PCCMT, SERCA2 and IP3R1) also showed decreased expression in the brain of an early-onset SCA1 patient, relative to agematched controls. Alpha1-antichymotrypsin, which is upregulated in the mutant mice, was also upregulated in the human patient. Consistent with the conclusions of Lin et al.1, unpublished work from one of our laboratories (G.A.) has indicated that a number of transcripts 103
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
ronal death later in the disease process, and if so, by what mechanism? Here we can only speculate. PCCMT is involved in the post-translational modification of many proteins, any one of which might be involved in neuronal degeneration. The other downregulated genes are involved in regulating cytoplasmic calcium and glutamate neurotrans mission; IP3R1 stimulates intracellular Ca2+ release, INPP5A may act to terminate the biological activity of IP3, SERCA2 and TRP3 are both involved in calcium flux across membranes, and EAAT4 is involved in clearing excess glutamate from the extracellular space. One plausible hypothesis is that downregulation of Fig. 1. Pre- and postsynaptic neurons, with intervening synaptic cleft. these genes might Shown are some of the molecules implicated by transcript profiling in promote excitotoxicithe earliest stages following expression of pathologically expanded ty, a well-characterataxin-1 (courtesy of D. Leja). ized phenomenon in which neurons die by apoptosis due to overexcitation of glutamate receptors and a consequent increase involved in regulating calcium, inositol in cytoplasmic calcium5. Consistent with and glutamate neurotransmission show altered expression in the striatum of this idea, many of the neurons affected presymptomatic and early-stage Huntin the different polyglutamine disorders ington’s disease patients. show strong staining with various calciThe findings of Lin et al.1 raise two um-regulating proteins and receive glutamatergic synaptic input 6. Moreover, fundamental questions that must be answered before the pathogenesis of excessive activation of NMDA-type gluSCA1 can be understood. First, we want tamate receptors can produce a clinical to know how the mutant ataxin leads to and neuropathological pattern reminisaltered gene expression. The possibilicent of Huntington’s disease in animals7, ties include a direct effect on the tranand overstimulation of AMPA-type gluscription of specific genes, a more global tamate receptors can trigger the selective effect on chromatin structure, nuclear degeneration of Purkinje neurons of the architecture or transcription factor stacerebellum. Clearly these issues cannot bility, or a change in the stability of parbe resolved simply by looking at tranticular RNA trancripts. With the scriptional profiles, but the availability availability of a mouse model for the of mouse models should allow more disease, this is likely to become an area direct genetic and physiological tests of of intensive inquiry. the excitotoxicity hypothesis. Second, are these early changes in As we noted at the outset of this artigene expression the actual cause of neucle, the significance of these findings 104
extends beyond the polyglutamine disorders. Various abnormal cellular processes have been proposed as the first steps in the eventual neuronal loss observed in all of the major neurodegenerative diseases, including both Alzheimer’s and Parkinson’s disease. Among the leading candidates are protein aggregation, damage from oxygen free radicals (oxidative stress)8 and excitotoxicity, any of which, alone or in combination, could result in the induction of apoptosis. Which of these are late phenomena, and which are important at the earliest stages of disease? In principle, these questions can be addressed in carefully staged human brain tissue, but in practice such material is not readily available, meaning that mutant mice of the type used by Lin et al. are likely to be central in future advances. Although the implications of this study must still be considered tentative, it is striking that so many of the early changes seen by Lin et al. are consistent with an effect on excitotoxicity, whereas none seems to implicate oxidative stress as an early event in the SCA1 mouse model. The notion that dysregulation of glutamate and calcium signaling is a very early event in the progression of neurodegeneration will, if substantiated by future work, stimulate the design of therapeutic approaches that may eventually make a difference to the clinical management of many neurodegenerative conditions. Indeed, a number of pharmacological compounds that influence calcium and glutamate homeostasis are already available, and one such compound, riluzole, has proven to be the most effective therapy so far in patients with amyotrophic lateral sclerosis, a neurodegenerative disease of the spinal cord with an entirely different etiology than the polyglutamine disorders9. 1. Lin X., Antalffy, B., Kang, D., Orr, H. T. & Zoghbi, H. Y. Nat. Neurosci. 3, 157–163 (2000). 2. Lunkes, A., Trottier, Y. & Mandel, J. L. Essays Biochem. 33, 149–163 (1999). 3. Orr, H. T. et al. Nat. Genet. 4, 221–226 (1993). 4. Klement, I. A. et al. Cell 95, 41–53 (1998). 5. Schwarcz, R., Foster, A. C., French, E. D., Whetsell, W. O. Jr. & Kohler, C. Life Sci. 35, 19–32 (1984). 6.
Greenamyre, J. T. 1058–1063 (1986).
Arch.
Neurol.
43,
7. diFiglia, M. Trends Neurosci. 13, 286–289 (1990). 8. Beal, M. F. Ann. Neurol. 38, 357–366 (1995). 9. Doble, A. Pharmacol. Ther. 81, 163–221 (1999).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
Non-invasive visualization of cortical columns by fMRI Amiram Grinvald, Hamutal Slovin and Ivo Vanzetta
© 2000 Nature America Inc. • http://neurosci.nature.com
Functional magnetic resonance imaging can now resolve individual cortical columns, which should provide insights into sensory perception and higher cognitive functions. Mountcastle1 and Hubel and Wiesel2 originally showed that many complex neural networks display meticulous order. Neurons with common functional properties are often clustered together in columns, 200−1000 µm wide, which span the depth of the cortex. To discover principles underlying implementation of the ‘neural code’, we must understand functional organization across the sheet of cortical columns during sensory processing and cognitive tasks. Brain organization has been visualized3 with positron-emission tomography (PET), optical imaging of intrinsic signals and, most recently, functional magnetic resonance imaging (fMRI). Optical imaging allows detailed visualization of cortical columns (spatial resolution of 20−100 µm, verified by extensive single-neuron and histological mapping), but it is invasive and thus unsuitable for use in humans. PET and fMRI offer spectacular three-dimensional localization of activity in humans, but have lacked the spatial resolution to reveal cortical columns. These techniques depend on the pioneering finding of Roy and Sherrington4 that changes in electrical activity are coupled to microcirculation responses, whose regulation is still being explored. Neural activity locally increases metabolic demands for glucose and oxygen, and the brain microcirculation responds—much less locally—by increasing blood volume and flow. In PET, this enhanced blood flow is visualized by injecting radioactive material into the circulation. Blood oxygenation level-dependent5 (BOLD) fMRI instead uses concentration changes in paramagnetic deoxygenated hemoglobin as an intrinsic contrast agent. In optical imaging, this contrast agent yields highresolution maps of cortical columns6,7, and BOLD imaging was hoped to have similar potential. Kim and colleagues 8 now report a striking technical advance in The authors are in the Department of Neurobiology, The Weizmann Institute of Science, Rehovot 76100, Israel. e-mail:
[email protected]
fMRI, achieving sufficient spatial resolution to directly visualize cortical columns responsible for shape perception in visual cortex of anesthetized cats. Instead of the traditional positive BOLD fMRI signal, the authors used an earlier, negative phase of the signal, termed the ‘initial dip’ (deoxygenation phase; Fig. 1b in ref. 8), to obtain single-condition maps of cortical columns. They further showed that the traditional BOLD signal (positive hyperoxygenation phase) gives less precise resolution than this early phase. Because it remains controversial exactly how electrical activity is coupled to such metabolic responses, skeptics question whether imaging maps based on microcirculation responses indeed represent the brain’s electrical activity or just hemodynamics. Thus methods to distinguish between ‘brain and vein’9 are critical. After Kim and colleagues presented their results 8 at the 1999 Society for Neuroscience meeting, some felt that neuroscientists’ fantasy might soon become reality. For others, questions remained. Exactly how is cortical electrical activity related to various hemodynamic responses? Why was the initial dip not observed in most previous studies? What are the implications for standard low-resolution fMRI at low field strength? Can the impressive single-condition orientation columns obtained by fMRI in the anesthetized cat also be visualized in awake animals? Are these results relevant to primates? The relationship of electrical activity to hemodynamic responses has been addressed by optical imaging 6,7,10,11 . Because the spatial resolution of the optics is less than 1 µm, this method permits unambiguous identification of blood-vessel-derived artifacts, distinguishing them from cortical activation per se. In addition, photons are cheap, so one can collect plenty of them; thus the signal-to-noise ratio is higher than for fMRI. This allows direct visualization of hemodynamic changes without elaborate image processing or statistics. Below we address these five remaining questions by presenting
nature neuroscience • volume 3 no 2 • february 2000
our own optical imaging data showing ocular dominance columns in behaving monkeys (Figs. 1 and 2) and by referring to previous work using biophysics and optical imaging. We determined the activity-dependent spatiotemporal characteristics of hemodynamic events, including oxygen delivery, blood flow and blood volume, at the onset of cortical activity triggered by sensory stimulation. The first event is a prolonged increase in oxygen consumption, caused by an increase in oxidative metabolism of activated neurons, leading to an increase in the deoxyhemoglobin concentration starting less than 100 ms after activity onset10,11. Upon illumination at 605 nm, this early event causes cortical darkening (Figs. 1b, middle panel, and 2b) known to be colocalized with the site of electrical activity in columns (see Fig. 4 in ref. 7). The second event originates from a delayed increase in blood volume, starting about 300−500 ms later10, caused by capillary dilation, which also causes cortical darkening, particularly apparent in larger blood vessels (Figs. 1c and d, middle panel, and 2e). Blood volume changes occur almost simultaneously in the three vascular compartments and are not well regulated within individual cortical columns (Fig. 4 in ref. 7). The third event is an activity-related increase in blood flow, as blood rushes into capillaries. Starting about 0.5−1.5 seconds after the onset of electrical activity, this decreases deoxyhemoglobin concentration and increases oxyhemoglobin concentration. The delayed deoxyhemoglobin decrease is much larger than the initial increase, causing delayed cortical whitening, particularly apparent in larger blood vessels (Fig. 1b and c, right). Unlike the early deoxygenation phase, this delayed increase is not localized with columnar electrical activity. Thus, changes in deoxyhemoglobin concentration follow a biphasic time course: a deoxyhemoglobin increase because of increased oxidative metabolism of active neurons the initial dip and then a decrease due to large overcompensation by enhanced blood flow (Figs. 1b and 2b). Obviously, increased oxidative metabolism must localize with electrical activity. With high-field fMRI, Logothetis and colleagues12 observed the initial dip in cortical regions without large vessels but not in large vessels, whereas the late BOLD component was detectable in both compartments (see Fig. 5 in ref. 12). These findings support the claims of Kim and colleagues8 that the initial fMRI dip shows better spatial specificity. Thus, cortical 105
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
Fig. 1. Comparison between differential and single-condition maps of ocular dominance columns, visualized by optical imaging. A cranial window was implanted over the primary visual cortex of a macaque. The exposed cortical surface of the behaving monkey was illuminated at 605 nm to emphasize small changes in deoxyhemoglobin concentration. Each row represents a time series, taken at roughly two-second intervals beginning one second before stimulus onset. (a) Differential images, obtained by subtracting images obtained with left- versus right-eye stimulation. To show time development of the differential map, all images are clipped at the same range. (Clipping is determining the range and mean of the gray scale's contrast.) (b) Corresponding single-condition maps obtained by normalizing the cortical image to illumination intensity without any additional processing, when the contralateral eye viewed the stimulus. To emphasize the slow global changes, a fixed-range clipping with fixed mean values was used. (c) As in (b), but to emphasize the small changes, a fixed range was used without a fixed mean. (d) As for (b), but to maximize the dynamic range of each map, autoclipping was used. Note that the signal-to-noise ratio in a differential image is much higher than that obtained for a single-condition map. Scale bar, 1 mm.
electrical activity is most tightly coupled to hemodynamic events during the initial dip. Because the initial dip is localized with neuronal activity, whereas the subsequent larger decrease in deoxyhemoglobin is not, there is a time window during the first three or four seconds in which functional maps indeed correspond to electrical activity. In contrast, delayed microvascular events such as volume and flow changes, which are not localized with electrical activity, may yield ‘hemodynamic maps’ that do not correspond to electrical activation (compare Fig. 2g and h with Figs. 3a and b and 4c in ref. 8). Why have low-field (0.5−1.5 T) BOLD fMRI measurements failed to detect the initial dip observed by Kim and colleagues with high-field (4.7 T and 9.4 T) magnets and by optical imaging? One possibility is that low-field measurements are not sufficiently sensitive to deoxyhemoglobin concentration changes in cortical capillaries. Both theoretical and experimental 106
evidence suggest that the amplitude of the initial dip depends on the second power of the field strength (K. Ugurbil, personal communication). The existence of the initial dip has been confirmed by several groups using 4 T fMRI in humans13. For those debating whether to purchase ultraexpensive high-field magnets, it will be critical to establish the relative amplitude and signal-to-noise ratio of the initial dip as a function of field strength. Kim and colleagues reported singlecondition maps (Fig. 2a–d in ref. 8). To understand the implications of their advance for standard low-field fMRI research (the third question), we must clarify the advantages and limitations of ‘single-condition mapping’ compared with ‘differential mapping’ (for details, see ref. 3, pages 918–921). The spatial resolution of a functional map depends on the spread of a particular imaged signal beyond the site of electrical activity, signal-to-noise ratio and the instrument’s
spatial resolution. The point spread of the fMRI signal is large relative to cortical column diameter14. However, differential imaging can resolve two distinct cortical activation sites at distances much smaller than half the width of the signal spread, if the signal-to-noise ratio is adequate. Indeed, ocular dominance columns in humans have already been imaged with fMRI by this method 15 (see also T.W. James et al. Soc. Neurosci. Abstr. 25, 212.5,1999; Tanaka et al., Soc. Neurosci. Abstr. 25, 572.3, 1999). As discussed above, both optical imaging and BOLD fMRI signals have multiple components. The ‘local’ component probably originates from oxygen extraction from the capillaries; thus it is most closely coupled to electrical activity and most stimulusspecific. This component is particularly enhanced during the initial dip, before delayed hemodynamic events begin to obscure it. The global signal7,10 refers to the sum of all the components, which originate from this deoxygenation and other sources, such as nonlocalized blood-volume and blood-flow changes (black and white vessels, respectively, in Fig. 1a–d, late frames). Most of the integrated global signal is associated with these last two components, which may not be stimulus-specific as they reflect hemodynamic activation of venules and large draining veins far from the electrical activation site7,10. For this reason, when two stimuli are orthogonal—meaning that they activate neurons in complementary cortical patches—comparing their activation patterns enhances the signal’s local component, while eliminating many, though not all, global components. Therefore, when the assumptions discussed below are fully justified, differential imaging may reveal the correct pattern of electrical activation. Such maps may even yield a better signal-to-noise ratio than maps derived from the shorter period and smaller amplitude of the initial dip. However, differential imaging has two major limitations. First, it works perfectly only if stimuli are orthogonal in the above sense, such as orthogonal oriented stimuli activating orientation columns in cats and monkeys. Even for ocular dominance maps, the stimuli are not strictly orthogonal because contralateral activation is stronger than ipsilateral activation, so that blood vessel-derived artifacts may be the largest signals in differential maps computed from late hemodynamic responses (Fig. 2c and compare early vascular artifacts in Fig. 2f with late ones in Fig. 2i). More generally, functional map
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
news and views
Finally, skeptics wondered whether single-condition orientation columns obtained in anesthetized cats 8 can be visualized in awake animals, and whether these results are relevant to primates. Our new results from awake monkey cortex (Figs. 1 and 2), which agree with those of Kim and colleagues8, address both these concerns. Hence it seems reasonable to hope that human brain imaging with fMRI will also allow Fig. 2. Comparison between single-condition and differential maps high-resolution singleobtained during the initial dip (deoxygenation phase) and later rise condition mapping. (hyperoxygenation phase). (a) Cortical image taken in green light to Kim and colleagues emphasize the vascular pattern. Scale bar, 1 mm. (b) Time course of accomplished the difthe amplitude of the global signal obtained from the single-condition ficult feat of singlemaps. (c) Time course of vascular artifacts and of the mapping signal condition mapping by amplitude calculated from the differential map. (d−f) Maps from the early deoxygenation phase. (d) Single-condition map for the con- integrating BOLD sigtralateral eye. (e) As in (d), for the ipsilateral eye. (f) The differential nals mainly during the map. (g−i) As for (d−f), from the late period. Note that during this small initial dip. As any new late time, the most prominent signals in the rather poor single-condi- with tion maps (g, h) are artifacts from blood vessels (diameter 50−150 approach, additional µm). Although these ‘brain or vein’ artifacts are minimized by differ- research will undoubtential mapping (f), at least with optical imaging, they are larger than edly strengthen this the columnar signal. work’s foundations. First, the authors did not present unequivocal single-neuron confirmation, or conamplitudes can be three- to tenfold smallfirmation by two-deoxyglucose er than ocular dominance column maps autoradiography or optical imaging, shown here, making vessel-derived artiwhich would be even better. However, the facts far more problematic. Furthermore, complementary nature of the single-conorthogonal stimuli may be impossible to dition maps for the two sets of orthogodesign, particularly for columns reprenal orientations strongly suggests that senting higher cognitive functions. Sectheir maps were indeed orientation maps. ond, by far the largest signals are from Second, their choice of threshold, a critidraining veins, even those smaller than cal step in obtaining single-condition 100 µm (cortical vasculature image, maps, was arbitrary. A ‘cocktail blank’ Fig. 2a; vascular artifacts Fig. 2c and g–i). (average response to four stimuli, a rough Such large signals may spread 3–7 mm approximation for uniform cortical actifrom the sites of electrical activity (A. vation elicited by many stimuli) was used Shmuel et al., ISMRM abstract, in press; instead of a real blank (no stimulus). D. Shoham and A.G., unpublished Third, one would expect a small negative results). Most important, signals from BOLD signal also for the orthogonal orisuch draining veins may be stimulus-speentation, rather than a flat line or a small cific and highly reproducible. Therefore, positive signal (Fig. 2e and f in ref. 8). use of differential imaging, high threshThis last reservation may suggest that curolds, signal averaging and statistics does rent signal-to-noise ratio is not good not guarantee removal of such artifacts. enough yet. Such single-condition mapSingle-condition mapping, in which the ping is difficult even with optical imagresponse to a single stimulus is imaged ing. (Cocktail blanks are commonly used directly, thus has great advantages over in optical imaging studies as well 3 .) differential imaging and should be the ultimate goal of high-resolution funcTherefore, future work should emphasize tional brain imaging. increasing signal-to-noise ratio, and addinature neuroscience • volume 3 no 2 • february 2000
tional technical improvements are still required before high-resolution singlecondition mapping becomes a ‘gold standard’ procedure easily achieved by fMRI. Such improvements might include extensive averaging, use of different MRI sequences, improved ways to reject vascular artifacts or reliance on MRI signals other than BOLD. The advance described by Kim and colleagues8 represents a major step forward in functional brain imaging. It should lay the foundation for exploration of the human brain at the fundamental level of its columnar architecture. This approach may revolutionize fMRI studies by allowing them to address not only where but also how processing and computations are carried out by individual cortical columns. The combination of fMRI with techniques that reveal cortical dynamics in the millisecond time domain, such as electroencephalography and magnetoencephalography, is also warranted. In conjunction with such methods, fMRI will become a powerful non-invasive tool both in biomedicine and in basic research of neurophysiology underlying higher brain functions, thus bridging the gap between psychology and neurobiology. 1. Mountcastle, V. B. J. Neurophysiol. 20, 408–434 (1957). 2. Hubel, D. H. & Wiesel, T. N. J. Physiol. (Lond.) 160, 106–154 (1962). 3. Windhorst, U. & Johansson, H. (eds) Modern Techniques in Neuroscience Research (Springer, New York, 1999). 4. Roy, C. & Sherrington, C. J. Physiol (Lond.). 11, 85-108 (1890). 5. Ogawa, S., Lee, T. M., Kay, A. R. & Tank, D. W. Proc. Natl. Acad. Sci. USA 87, 9868–9872 (1990). 6. Grinvald, A., Lieke, E., Frostig, R. D, Gilbert, C. D. & Wiesel, T. N. Nature 324, 361–364 (1986). 7. Frostig R. D., Lieke, E., Ts’o, D. Y. & Grinvald, A. Proc. Natl. Acad. Sci. USA 87, 6082–6086 (1990). 8. Kim, D.-S., Duong, T. Q. & Kim, S.-G. Nat. Neurosci. 3, 164–169 (2000). 9. Frahm, J. Merboldt, K. D., Hanike, W., Kleinschmisdt, A. & Boeker, H. NMR Biomed. 7, 45–53 (1994). 10. Malonek, D. & Grinvald, A. Science 272, 551–554 (1996). 11. Vanzetta, I. & Grinvald, A. Science 286, 1555–1558 (1999). 12. Logothetis, N. K., Guggenberger, H., Peled, S. & Pauls, J. Nat. Neurosci. 2, 555–562 (1999). 13. Hu, X., Le, T. H & Ugurbil, K. Magn. Reson. Med. 37, 877–884 (1997). 14. Engel, S. A., Glover, G. H. & Wandell, B. A. Cereb. Cortex 7, 181–192 (1997). 15. Menon, R. S., Ogawa, S., Strupp, J. P. & Ugurbil, K. J. Neurophysiol. 77, 2780–2787 (1997).
107
© 2000 Nature America Inc. • http://neurosci.nature.com
brief communications Rapid, synaptically driven increases in the intrinsic excitability of cerebellar deep nuclear neurons Carlos D. Aizenman and David J. Linden Department of Neuroscience, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, Maryland 21205, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to D.L. (
[email protected])
The neurons of the cerebellar deep nuclei are implicated in certain forms of motor learning such as associative eyeblink conditioning, partly because increases in their firing rates parallel acquisition of the conditioned response. Here we demonstrate that these neurons can show persistent increases in their intrinsic excitability following a Ca 2+ load imposed by synaptic activation of NMDA receptors or direct current injection. This phenomenon, together with use-dependent alterations in synaptic strength, may
a Fig. 1. Tetanization of excitatory synapses produces a sustained increase in intrinsic excitability of DCN neurons (a) Averaged time course of the number of spikes evoked during 200 ms, depolarizing current test pulses. Control experiments (open circles) represent the baseline. Following a synapticconditioning tetanus (at arrowheads), number of spikes evoked by the test stimulus slowly increases (filled circles). (b, c) Representative traces evoked by a +0.5 nA test pulse in tetanized and control experiments at the time points indicated by asterisks. Traces evoked by subthreshold test pulses (–0.1 and +0.1 nA; b) demonstrate that Rinput remains stable when the spiking evoked by a larger depolarizing test pulse increases. Examples are shown from two different cells, one that fired in regular spiking mode (top traces) and one that fired in burst mode (bottom traces). (d) A cumulative probability distribution shows the resulting increase in the number of spikes measured at 20–25 min for tetanized and control groups shown in (a). (e) The number of spikes evoked by depolarizing test pulses is plotted as a function of the amplitude of injected current for four separate experiments. Solid lines represent the function immediately before and dashed lines 20 min after the synaptic tetanus. Error bars for (a) and (e) represent s.e. Experiments used coronal slices of 13–15 day-old rat cerebellum as described9. Slices recorded using microelectrodes (80–150 MΩ) containing 3 M potassium acetate were maintained at 33°C in an interface chamber and perfused with ACSF containing 126 mM NaCl, 5 mM KCl, 3 mM CaCl2, 1 mM MgSO4, 26 mM NaHCO3, 1.25 mM NaH2PO4, 20 mM D-glucose and 0.2 mM picrotoxin and bubbled with 95% O2/5% CO2.
provide a flexible and informationally rich engram for cerebellar motor learning. Long-term synaptic potentiation and depression (LTP and LTD) are considered computationally powerful, in part because they allow for the synapse-specific modification of a large array of inputs. Less attention has been paid to the idea that information storage may involve activity-dependent changes in the intrinsic excitability of neurons. This type of plasticity would affect postsynaptic signals evoked by many (or possibly all) synapses impinging on a neuron, depending on the identity and location of the intrinsic conductances altered, thereby creating a more global change in signal integration. Slow, activity-dependent changes in the intrinsic excitability of both invertebrate and mammalian neurons have been reported in cell culture systems1,2. Persistent changes in intrinsic neuronal excitability can also be induced somewhat more rapidly. In the mollusk Hermissenda, associative pairing of light and rotation produces a long-term increase in the intrinsic excitability of type B photoreceptors due to a reduction of K+ currents3. A similar effect is observed in CA1 pyramidal neurons of the rabbit hippocampus following trace eyeblink conditioning4. In hippocampal LTP, increases in the probability of a cell firing an action potential for a given size EPSP accompanies
b
d
c
e
nature neuroscience • volume 3 no 2 • february 2000
109
© 2000 Nature America Inc. • http://neurosci.nature.com
brief communications
© 2000 Nature America Inc. • http://neurosci.nature.com
a
tion storage for associative eye-blink conditioning 8. Microelectrode recordings were made from neurons in the DCN of juvenile rat cerebellar slices as described9,10. Picrotoxin (200 µM) was added to block GABA A receptors. To record changes in intrinsic excitability, the cell was tonically hyperpolarized to suppress spontaneous spiking, and a b short depolarizing test pulse (250 ms, 0.1–0.5 nA), which evoked a small number of action potentials (typically 1–4), was then used as a baseline measure. Repeated application of this test pulse alone did not alter the number of evoked spikes, as stable responses could be recorded for more than > 25 min (Fig. 1a and c). After a baseline period, an excitatory synaptic tetanus was applied to the DCN neuc ron via a stimulating electrode placed in the adjacent white matter. The tetanus (10 highfrequency bursts applied at 4 Hz; each burst comprising 10 pulses delivered at 100 Hz) was repeated 5 times. In 8 of 9 cells, the number of spikes evoked by the test pulse increased in response to this synaptic-conditioning tetanus, stabilizing in 15–20 minutes (Fig. 1a and b). The number of spikes evoked by the test pulse was significantly increased by the tetanus d (n = 9; before, 4 ± 1; increase, 8 ± 2; p < 0.01, Student’s t-test; Fig. 1d).When Rinput was measured using a hyperpolarizing current pulse, no significant change was observed 20 min after the tetanus (114 ± 10% of baseline, n = 4). Furthermore, synaptic tetanization did not produce a significant change in the amplitude of the first spike evoked by the depolarizing test pulse (98 ± 2% of baseline, n = 9). Experiments were excluded if the amplitude of the first evoked spike decreased by >10% Fig. 2. Sustained increases in intrinsic excitability of DCN cells require Ca2+ influx. (a) Averaged at any point in the recording, if the cell exhibtime course and sample traces from experiments in which 50 µM D-AP5 was applied before ited spontaneous spiking between test stimsynaptic tetanization. (b) Sustained increases in spike firing could also be induced by applying an uli or if the recording could not be intracellular conditioning tetanus consisting of depolarizing current pulses (indicated by arrowmaintained for 20 min following the condihead; see text). (c) Bath-applied 200 µM Cd2+ blocked increases in spiking induced by the same tioning stimulus. Input–output curves were intracellular conditioning stimulation given in (b). (d) Changes in the late/peak EPSP amplitude ratio, measured 15–20 minutes after synaptic tetanization under different experimental condi- then plotted relating injected depolarizing tions. There was no significant change in the amplitude of the EPSP peak (left). Arrows indicate current to the number of evoked spikes immediately before or 20 minutes after the EPSP waveforms sampled 20 minutes post-tetanus. synaptic conditioning tetanus (Fig. 1e). Increased excitability was clearly associated with reduced spike threshold in three of four cells. Additionally, in 2/4 cells, maximum spiking rate evoked by increases in synaptic strength. This phenomenon has been called the largest test pulses increased. These results indicate that exciEPSP-to-spike (E–S) potentiation. However, as E–S potentiation tatory synaptic tetanization produced a change in intrinsic postis generally occluded by GABAA receptor antagonists, it is prosynaptic excitability that did not merely reflect alteration in the posed not to reflect changes in intrinsic postsynaptic conducmicroelectrode or the general health of the impaled cell. tances, but rather to represent a decrease in the ratio of We wished to determine the initial signals required for this feedforward inhibition to excitation yielding a net increase in change in intrinsic excitability. The synaptic conditioning tetanus excitability5. However, based on indirect measures using field evoked spiking (66 ± 12 spikes per burst, n = 9, range, 17–130 potentials6 or intracellular recording with direct current injection spikes per burst), but the number of spikes evoked during the (but without blocking GABA receptors, allowing confounding synaptic conditioning tetanus was uncorrelated with resulting changes in tonic inhibitory drive)7, others claim that E–S potenchanges in excitability (increase in number of spikes evoked by tiation reflects an increase in intrinsic excitability. a test pulse; r = –0.34, p > 0.10). To further characterize the The neurons of the deep cerebellar nuclei (DCN) integrate requirements for this effect, synaptic conditioning tetani were excitatory and inhibitory inputs representing several streams of applied during bath application of 50 µM D-AP5, an NMDA sensory/motor information, and are a proposed site of informa110
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
brief communications
receptor antagonist. The number of spikes induced during the synaptic conditioning tetanus in D-AP5 was adjusted so that it was not significantly different from that without drug (p = 0.498, Kolmogorov-Smirnov). With D-AP5, the conditioning tetanus failed to produce an increase in the number of spikes evoked by the test pulse (0.4 ± 1 spikes, p = 0.83, Student’s t-test, n = 5; Fig. 2a), indicating that Ca2+ influx through NMDARs is required. However, this requirement for NMDAR activation does not preclude contribution of other receptors such as mGluRs or AChRs to this effect. Depolarizing pulses that evoke substantial spiking in DCN neurons cause large intracellular Ca2+ transients in both the soma and dendritic arbor9,12, sufficient to evoke LTP of IPSPs9. We then tested whether depolarizing current pulses alone could affect the excitability of DCN neurons without synaptic stimulation. An intracellular conditioning stimulus (pulse amplitude, +0.5 nA; duration, 100 ms; applied at 4 Hz and delivered 5 times through the recording electrode) caused a marked, gradual increase in the number of spikes evoked by the test pulse (increase of 6 ± 2 spikes; p = 0.016, Student’s t-test, n = 7, Fig. 2b). When influx of Ca2+ was prevented by 200 µM Cd2+, spiking did not significantly increase (1 ± 0.3; p = 0.097, Student’s t-test; n = 4, Fig. 2c). Alterations in dendritic or somatic voltage-gated channels could alter the kinetics of EPSPs. To test this, we delivered a synaptic conditioning tetanus after collecting a 10-min baseline of EPSPs. The synaptic tetanus caused an inconsistent change in the peak EPSP amplitude ranging from LTP to LTD with many cases of no change at all. To analyze EPSP kinetics, amplitude measurements were taken at both the peak and a time at which the averaged baseline EPSP waveform had decayed to 50% of its peak amplitude. These measurements were then normalized to the peak amplitude of each EPSP and analyzed as the ratio of late/peak EPSP amplitude. Synaptic conditioning significantly increased this ratio (121 ± 8% of baseline, p = 0.026 Student’s ttest, n = 13) even when there was no change in the peak amplitude, indicating that conditioning caused the EPSP to decay more slowly (Fig. 2d). As in experiments in Fig. 1b and c, Rinput was unaltered by the synaptic tetanus (106 ± 3% of baseline, n = 13, Fig. 2d). EPSP broadening could be partially suppressed by 50 µM D-AP5 (109 ± 2, p = 0.02 Student’s t-test, n = 4). As a test of whether this broadening could result from increases in the proportion of slower NMDA to faster AMPA currents underlying the EPSP, the experiment was repeated with an AMPA receptor antagonist, NBQX (10 µM). A substantial EPSP could be evoked in the presence of NBQX even when the cell was held at negative membrane potentials (below –80 mV), probably because of Mg2+-insensitive NR2D receptor subunits found in the DCN11. This NMDAR-mediated EPSP also showed a broadening of the EPSP waveform (116 ± 7%, p = 0.03 Student’s t-test, n = 12), suggesting that the observed change in EPSP decay kinetics involved either a change in intrinsic postsynaptic conductances, as observed in hippocampal CA1 pyramidal neurons13, or, alternatively, a selective change in the NMDAR kinetics. We noted a high degree of heterogeneity in the firing modes of the cells sampled for these experiments, which ranged in a continuum from regular spiking (Fig. 1b, top traces) to burst firing (Fig. 1b, bottom traces). This heterogeneity may reflect different modulatory states of the DCN neurons10. We tested whether the propensity of the cell to burst correlated with the amount of change in intrinsic excitability resulting from synaptic or depolarization conditioning by relating the averaged first inter-spike interval during a test pulse within the baseline period (cells with a greater propensity to burst have a shorter first interspike internature neuroscience • volume 3 no 2 • february 2000
val) with the resulting increase in the number of spikes. We saw no correlation between these two measures (r = 0.1, p > 0.1), indicating that the cell’s firing mode did not correlate with its ability to undergo long-term changes in intrinsic excitability. Moreover, we did not observe a strong tendency for cells to switch firing mode following the conditioning. Our main finding is that either synaptically driven activation of NMDA receptors or Ca2+ influx driven by direct depolarization can trigger a rapid and persistent increase in the intrinsic excitability of DCN neurons. This increase took the form of a reduction in spike threshold and/or an increase in the maximum firing rate. At present, we have no direct evidence to implicate any particular conductance in this effect. However, the excitability of these cells is strongly modulated by a hyperpolarization-activated cation current (Ih), a low threshold voltage-sensitive Ca2+ current (ICa(T))and an apamin-sensitive Ca2+-gated K+ current10. As the increase in intrinsic excitability seemed to require a Ca2+ transient, it is possible that the relevant ion channels were altered by a Ca2+-dependent signaling cascade such as PKC or Ca2+-sensitive adenylyl cyclase/PKA. Activation of these signaling systems produces transient effects on intrinsic excitability in hippocampal neurons, at least in part, through actions on Ca2+-gated K+ channels14,15. How might alterations of intrinsic excitability of DCN neurons contribute to information storage in the cerebellum? Although not directly tested, the Ca2+ transient produced by a burst-and-pause stimulus delivered to the GABAergic Purkinje cell–DCN synapses9 probably would also be a sufficient signal to induce this change. This could provide a framework for heterosynaptic interaction between excitatory and inhibitory inputs to the DCN. In addition, a striking observation regarding associative eyeblink conditioning is that extracellular records of spike firing in the DCN show patterns of increased activity that correlate with the development of the conditioned response8. The most common explanation for this observation is that these increases reflect decreased inhibitory drive from Purkinje cells and/or increased excitatory drive from mossy fibers. Our results suggest that increases in intrinsic excitability could potentially complement input-specific alterations in synaptic strength to give rise to a flexible and informationally rich engram.
ACKNOWLEDGEMENTS We thank C. Hansel, A. Kirkwood, H.-K. Lee and S. Morris for suggestions. This work was supported by MH01590 and the Develbiss Fund (D.J.L.) and a fellowship from the Howard Hughes Medical Institute (C.D.A.).
RECEIVED 25 OCTOBER; ACCEPTED 16 DECEMBER 1999 1. Turrigiano, G., Abbot, L. F. & Marder, E. Science 264, 974–977 (1994). 2. Desai, N. S., Rutherford, L. C. & Turrigiano, G. Nat. Neurosci. 2, 515–520 (1999). 3. Alkon, D. L. J. Exp. Biol. 112, 95–112 (1984). 4. de Jonge, M. C., Black, J., Deyo, R. A. & Disterhoft, J. F. Exp. Brain Res. 80, 456–462 (1990). 5. Abraham, W. C., Gustafsson, B. & Wigström, H. J. Physiol. (Lond.) 394, 367–380 (1987). 6. Jester, J. M, Campbell, L. W. & Sejnowski, T. J. J. Physiol. (Lond.) 484, 689–705 (1995). 7. Pugliese, A. M., Ballerini, L., Passani, M. B. & Corradetti, R. Neuroscience 62, 1021–1032 (1994). 8. Raymond J. L., Lisberger S. G. & Mauk M. D. Science 272,1126–1131 (1996). 9. Aizenman, C. D., Manis, P. B. & Linden, D. J. Neuron 21, 827–835 (1998). 10. Aizenman, C. D. & Linden, D. J. J. Neurophysiol. 82, 1697–1709 (1999). 11. Cull-Candy, S. G. et al. Neuropharmacology 37, 1369–1380 (1998). 12. Muri, R. & Knöpfel, T. J. Neurophysiol. 71, 420–428 (1994). 13. Hess, G. F. & Gustafsson, B. Neuroscience 37, 61–69 (1990). 14. Baraban, J. M., Snyder, S. H. & Alger, B. E. Proc. Natl. Acad. Sci. USA 82, 2538–2542 (1985). 15. Madison, D. V. & Nicoll, R. A. J. Physiol. (Lond.) 372, 221–244 (1986).
111
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
A metabotropic glutamate receptor variant functions as a taste receptor Nirupa Chaudhari1, Ana Marie Landin and Stephen D. Roper1 Dept. of Physiology and Biophysics and 1Program in Neuroscience, University of Miami School of Medicine, P.O. Box 016430 (R430), Miami, Florida 33101, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to N.C. (
[email protected])
Sensory transduction for many taste stimuli such as sugars, some bitter compounds and amino acids is thought to be mediated via G protein-coupled receptors (GPCRs), although no such receptors that respond to taste stimuli are yet identified. Monosodium L-glutamate (L-MSG), a natural component of many foods, is an important gustatory stimulus believed to signal dietary protein. We describe a GPCR cloned from rat taste buds and functionally expressed in CHO cells. The receptor couples negatively to a cAMP cascade and shows an unusual concentration–response relationship. The similarity of its properties to MSG taste suggests that this receptor is a taste receptor for glutamate.
Chemoreceptor cells in taste buds monitor the chemical environment in the oral cavity and generate signals that lead to taste perceptions. Taste transduction for simple salts involves altered permeation of the receptor cell membrane by ions such as Na+, K+ or H+ (ref. 1). The resulting receptor currents in taste bud cells stimulate neurotransmitter release to excite sensory afferents, ultimately leading to perceptions such as ‘salty’ or ‘sour’. Taste transduction for larger organic molecules such as sugars, amino acids or a heterogeneous collection of compounds that elicit perception of bitterness, is thought to include binding at specific receptors on the taste cell plasma membrane1,2. Some of the proteins that orchestrate this plethora of sensory transduction mechanisms have been identified using molecular biological methods. Taste receptor cells express G proteins, including α-gustducin3, α-transducin4, a number of additional Gα subunits 5,6, several Gβ subunits and a taste-specific Gγ 7. Phosphodiesterases4 and a cyclic nucleotide-gated channel8 cloned from mammalian taste buds could potentially participate in sensory transduction pathways. Epithelial sodium channels demonstrated in taste buds presumably underlie ‘salty’ and ‘sour’ transduction9–11. Detectable receptor activity for ‘bitter’ stimuli is found in membrane preparations from taste tissue12. Although a number of candidate taste-GPCRs have been proposed13–15, their functional significance in taste transduction has not been established2. This report describes the cloning and functional characterization of a taste receptor and its natural taste stimulus. Sweet, sour, salty, bitter and (arguably) umami constitute basic taste qualities. Umami denotes the taste of the glutamate moiety in monosodium L-glutamate (L-MSG), a compound that occurs naturally in protein-rich and other foods. Taste transduction for glutamate is hypothesized to entail stimulation of neurotransmitter-like ionotropic and metabotropic glutamate receptors16–18. A number of ionotropic glutamate receptors are expressed in lingual tissue, although none seems preferentially localized to taste buds17. Metabotropic glutamate receptors (mGluR1–8) constitute a family of GPCRs that are found in many neuronal cells19. In taste receptor cells, molecular, physiological and behavioral evidence nature neuroscience • volume 3 no 2 • february 2000
implicates a metabotropic receptor similar or identical to mGluR4 in taste transduction for L-glutamate20. Such evidence includes the findings that mGluR4 is expressed in rat taste buds17,21 and that an mGluR4-selective ligand, L-AP4, mimics the taste of L-MSG in conditioned taste aversion in rats17 and in human psychophysical measurements22. Further, both L-MSG and L-AP4 interact synergistically with nucleotide monophosphates to elicit umami taste responses23,24. Additionally, stimulating taste buds with glutamate decreases cellular cAMP (X. Zhou & N. Chaudhari, Chem. Senses 22, 834, 1997) and alters membrane conductances25, a signaling cascade also triggered by mGluR4. Collectively, these findings are consistent with the transduction of L -glutamate taste by an mGluR4-like receptor. Nevertheless, several lines of evidence indicate apparent discrepancies between umami taste and the properties of mGluR4. The concentrations of glutamate needed to elicit taste and to activate the neurotransmitter receptor mGluR4 differ markedly. The detection threshold for L-MSG in recordings from sensory afferents is 0.1–0.3 mM in juvenile and 1–3 mM in adult rodents26,27, whereas mGluR4 requires glutamate in the micromolar range. Further, the ability of glutamate agonists to stimulate mGluR4 does not correlate fully with their umami taste28. Additionally, umami taste does not seem to be blocked by a known antagonist of mGluR423. These observations suggest that the receptor(s) transducing umami taste may differ significantly from mGluR4, particularly in the glutamate-binding domain. The glutamate-binding domain of the mGluR is contained within the large extracellular N terminus. Although detailed structural information is lacking, a model of the N terminus of mGluRs is based on the structure of a bacterial periplasmic leucine-isoleucine-valine binding protein (LIVBP)29. Experimental verification of this model includes mutation of contacting amino acids29, expression of truncated extracellular domains that retain binding characteristics30 and chimeric receptors with distinct agonist sensitivities31. Thus, the extracellular N terminus might be a plausible site for differences between neurotransmitter and taste receptors for glutamate. We found an unusual variant of mGluR4, taste-mGluR4, expressed in lingual epithelium. 113
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 1. The 5′ end of mGluR4 cDNA from taste papillae a contains novel sequence derived from an intron. (a) The 5′ end of mGluR4 cDNA from taste papillae (lower lines) is aligned with the corresponding region of mGluR4 cDNA from brain (upper lines). Amino acid (bold) and translated nucleotides (regular) for each sequence are numbered. A stop codon (), in frame with b the long open reading frame, is found within the novel region of the cDNA from taste tissue. Sequence identity between the two cDNAs begins abruptly at the codon for R291. This position also corresponds to the location of intron a (). (b) Schematic showing the full-length cDNA for mGluR4 from brain, including 5′ and 3′ untranslated regions (line), translated region (shaded bar) and regions encoding seven putative transmembrane segments (gray stripes). The 800-bp segc d ment (double line) expressed in rat taste buds17 as well as the 3′ and 5′ RACE products (**) we characterized are shown above the brainderived mGluR4 cDNA. The corresponding genomic organization shows two intervening sequences. The last 60 bp at the 3′ end of intron a (in black) are identical to the first 60 bp at the 5′ end of the taste-derived cDNA; the taste-derived cDNA includes part of intron a followed by exon N1. (c) mGluR4 mRNA from brain includes several exons upstream of N0, whereas mGluR4 mRNA derived from taste tissue begins with an extended exon N1 spliced to exon N2. In the taste-derived mRNA, the presence of the upstream stop codon prevents translation of the first 128 bp (white); translation presumably initiates at the next methionine codon (M309 in brain-derived cDNA). (d) Predicted transmembrane topology of brain- and taste-mGluR4 showing the truncated extracellular N terminal domain followed by seven putative transmembrane helices and cytoplasmic C terminus. The LIVBP-like glutamate-binding domain29 and its truncated version are shown as heavy lines.
The corresponding protein is predicted to lack approximately half the N terminus, including a large portion of the LIVBP-like putative glutamate-binding domain. Taste-mGluR4 cDNA expressed in CHO cells conferred sensitivity to L-glutamate at concentrations ~100-fold higher than needed for brain-mGluR4, and its expression level was negatively coupled to cAMP concentration. These findings correspond well with the concentrations of glutamate needed to elicit umami taste and resolve the discrepancy between neurotransmitter receptors for glutamate and taste receptors for glutamate. Some of these results were presented in abstracts (A. Fedorov & Chaudhari, N., Chem. Senses 23, 593, 1998; A. M. Landin et al., Chem. Senses 24, 586, 1999).
RESULTS In-situ hybridization shows that mGluR4 is expressed in rat taste buds and cannot be detected in surrounding non-sensory epithe114
lium17,21. However, it is unclear whether mGluR4 in taste buds is identical to that in the brain. Earlier RT-PCR and in-situ hybridization analyses focused on an ~800-bp core region conserved among mGluR1-8 (Double line in Fig. 1b). The N terminus of mGluRs comprises a large extracellular glutamate-binding domain29. The cytoplasmic C terminus of mGluRs participates in interactions with G proteins. Because N and C termini of mGluRs determine essential functional characteristics, we analyzed the corresponding sequences for mGluR4 expressed in taste tissue. Full-length cDNA for mGluR4 from taste tissue In the brain, mGluR4 mRNA is found in two forms, mGluR4a and mGluR4b, which differ at the 3′ end32. The longer mRNA includes an exon containing an in-frame stop codon, and thus generates a shorter protein product, mGluR4a. To analyze the C terminus of mGluR4 in taste cells, we used poly(A)RNA from taste (circumvallate and nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
foliate) papillae and gene-specific a b primers located in the previously characterized 800-bp core region. We performed 3′ RACE (rapid amplification of cDNA ends) reactions and cloned the longest specifically amplified bands. DNA-sequence analysis of representative clones yielded 100% identity with mGluR4a cDNA from the brain33. We also carried out RT-PCR with a primer pair straddling the alternatively spliced exon. The principal amplification product was confirmed by DNA sequence analysis to be mGluRa. A faint band corresponding in size to mGluR4b was detected Fig. 2. The truncated mRNA in taste papillae is a mature mRNA. (a) RT-PCR with a reverse primer (R) in exon only in occasional PCRs (not N2 and forward primers B (within exon N0) or T1, T2, T3 (within intron a) using poly(A)RNA from taste tissue shown). Thus, we conclude that or from brain. With taste RNA, PCR product is visible in lanes amplified with T1-R and B-R primer pairs but not the C-terminal sequence in taste with the T2-R or T3-R primer pairs, demonstrating that only a portion of intron a sequence is present in the tissue was predominantly of the RNA. With brain RNA used as template, PCR products are clearly seen with all three primer pairs, T1-R, T2-R and T3-R, implying that sequences from intron a are present in unspliced precursor for the known mGluR4 mGluR4a type. Gene-specific reverse primers mRNA. A 1-kb ladder (BRL) is in the far left lane. Schematics on the right show RNA templates postulated to yield the PCR products obtained (taste-mGluR4, precursor of brain-mGluR4 and mature brain-mGluR4, in the 800 bp core region were respectively). (b) RNase protection assay demonstrates that taste tissue contains significant amounts of the also used in 5′ RACE reactions. truncated mGluR4 RNA. [32P]-labeled probe was hybridized with poly(A)RNA from liver, cerebellum (0.05 µg, Previously cloned cDNAs for rat cer) and taste papillae (2–3 µg) from adult (ad) or juvenile (juv) rats. Lengths are indicated in nucleotides; RNA mGluR4a include a 5′ untrans- markers are on the left, and RNase-protected fragments are on the right. A schematic of the probe used (right) lated region (5′ UTR) of either shows exons (gray) and the segment of intron a found in taste-derived mGluR4 cDNA (black). 69 bp 33 or 854 bp 29. Thus, we estimated that our 5′ RACE products should range between 1450 and 2235 bp. Using brain poly(A)RNA to validate the (precursor) RNA rather than a mature mRNA. Because introns method, amplification products extending to ≥2000 bp were are spliced out intact, a precursor RNA should include the comobtained as expected. In contrast, the 5′ RACE product obtained in plete sequence of intron a. This prediction was tested by RT-PCR parallel from taste tissue terminated abruptly at approximately 600 (Fig. 2a). We used three forward primers (T1, T2 and T3) along bp. Similarly truncated products from taste-derived mRNA resultintron a. The reverse primer (R) was selected from a separate ed from 5′ RACE reactions with at least four different gene-spedownstream exon to preclude amplification from genomic DNA. cific reverse primers and two sources of reverse transcriptase. From brain poly(A)RNA, approximately equal amounts of product were detected for all three reactions using forward primers within intron a (Fig. 2a). This result implies that intron a may be A distinct mGluR4 cDNA found in taste tissue a late-spliced intron and that brain poly(A)RNA contains preSequence analysis of the cloned RACE product indicated that the cursor RNAs that include the complete intron. In contrast, taste 5′ terminal 40–60 bp of the taste-derived cDNA clones were not poly(A)RNA showed amplification product only from the farsimilar to any region of brain mGluR4 cDNA (Fig. 1a). A stop thest-downstream intronic primer, T1, and not from upstream codon was found near the 5′ end, in-frame with the long open primers T2 or T3. Thus, poly(A)RNA in taste tissue included only reading frame, implying that the 5′ end is untranslated sequence. a short segment from the 3′ end of intron a, suggesting that the We found two potential start codons in frame, 102 bp and 189 bp truncated mGluR4 cDNAs obtained in 5′ RACE were probably downstream of the stop codon. Thus, the sequence of mGluR4 derived not from an unspliced precursor RNA, but from a mature cDNA from taste tissue is unique for the first ~60 bp and then is mRNA. A forward primer (B) located in the next exon upstream identical for at least 2220 bp to mGluR4a cDNA from brain. (N0), amplified from the previously known mGluR4 mature The point of divergence between unique and identical sequences for taste- and brain-derived cDNAs, located at amino mRNA, served as a control. PCR product from mGluR4 mRNA acid R291 of mGluR4a, resembles a splice acceptor site. To test lacking this intron was detected in poly(A)RNA from both brain this, we analyzed a genomic fragment amplified from this region and taste papillae. Precursor RNAs are typically found in tissue and determined that an intron (intron a, Fig. 1b) interrupts the at considerably lower concentration than their respective mature codon for R291. The 3′ end of intron a is identical to the ~60-bp mRNAs. In taste tissue, the low concentration of mature fullunique sequence at the 5′ end of the taste-derived mGluR4 length mGluR4 mRNA17 precludes detecting its precursor RNA cDNAs (Fig. 1a and b). One additional intron was also identified (as RT-PCR products with T3 and T2 primers). further downstream. RNA secondary structure can cause premature termination of reverse transcripts and yield truncated products in 5′ RACE. This did not seem to be the case for the truncated taste-mGluR4 Taste-tissue mGluR4 is a mature mRNA cDNA because brain poly(A)RNA did yield long 5′ RACE prodThe presence of intron sequence in the taste-derived mGluR4 ucts, and because precursor RNAs in brain samples were readily cDNA raised the possibility that it was amplified from a nuclear nature neuroscience • volume 3 no 2 • february 2000
115
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
band, 254–263 nucleotides in length, as might be expected for an RNA that included the 178 nucleotides of exon (N 1 plus N 2) sequence and extended 76–85 nucleotides forward into intron a. This protected band was consistent with the mGluR4 cDNA cloned in the 5′ RACE experiments. The band was not detected in cerebellar RNA lanes. Thus, we designate this form of mGluR4 RNA, which includes a part of intron a, as ‘taste-mGluR4’. We note that the ~178-bp band Fig. 3. Taste-mGluR4 is activated by glutamate at much higher concentrations than brain-mGluR4. derived from brain-mGluR4 is (a) Immunoblot of CHO cells stably transfected with brain-mGluR4 (B) or taste-mGluR4 (T) shows a promi- sharp, as expected, whereas the nent immunoreactive band of predicted molecular weight (~102 kDa and ∼68 kDa, respectively) when probed broad taste-mGluR4-derived band with an antibody against the shared C terminus of both forms. CHO cells transfected with non-recombinant indicates more heterogeneity in vector (con) do not show either band. Extracts of cerebellum (cer) and brain-mGluR4 expressing CHO cells length. The 5′ ends of mRNAs frealso show a higher band, presumably a dimerized receptor at ≥208 kDa. (b) CHO cells expressing brain- quently show such heterogeneity, mGluR4 () and taste-mGluR4 () both respond to glutamate by decreasing cAMP levels. Cells were stimuspanning 3–15 nucleotides. lated with L-glutamate in the presence of forskolin and IBMX (see Methods). Six independent experiments We observed the broad band were carried out, each including triplicate wells of cells for each concentration. Three of the experiments corresponding to taste-mGluR4 were conducted on lines of clonal transformants and another three on non-clonal lines of stably expressing CHO cells. The values represent mean ± s.e.; the curves are a sigmoidal fit to the data. Control cells, trans- mRNA in three separate protection fected with the non-recombinant vector did not significantly alter cAMP levels when stimulated with L-gluta- experiments using different batchmate (1 mM, 127 ± 16.0%; 10 mM, 132 ± 19.0%; n = 9). The absolute values of cAMP per well in es of poly(A)RNA from taste tissue forskolin-stimulated cells in the absence of glutamate were: 6.07 ± 0.60 pmole, 6.88 ± 0.78 pmole and of juvenile rats. Densitometric 4.33 ± 0.42 pmole for cells transfected with brain-mGluR4, taste-mGluR4 and vector, respectively. analysis from three experiments indicated that taste-mGluR4 mRNA is present at 70–120% of the concentration of brainmGluR4 mRNA in taste tissue from juvenile rats. Interestingreverse transcribed and amplified through intron a (Fig. 2a). ly, the taste-mGluR4 band was found at lower concentration Thus, based on the 5′ RACE and RT-PCR analyses above, we tenwhen poly(A)RNA from adult rather than juvenile rats was tatively concluded that taste tissue may contain two forms of used for protection (Fig. 2b). mGluR4 mRNA—one similar to the known mGluR4a33 and another with a truncated 5′ end. Because RT-PCR can detect RNAs that are present in minor Taste-mGluR4 is a functional mRNA (nonphysiological) quantities in cells, we tested whether the trunTo determine whether taste-mGluR4 is a functional mRNA, we cated mGluR4 RNA found in taste tissue was present at significant generated full-length clones for both forms of mGluR4 in concentration using RNase protection (Fig. 2b), an independent pcDNA3.1 vector, transfected them into CHO cells and selected method not based on amplification. The probe for this assay constable transfectants. When probed with an antibody against the C sisted of the last ~400 nucleotides of intron a, followed by 178 terminus of mGluR4a, immunoblots (Fig. 3a) of cerebellar extracts nucleotides in two consecutive exons, N1 and (part of) N2. No contained a strong band of the expected molecular weight, ∼102 kDa, as previously reported34. A presumed dimer at ∼210 kDa was bands were generated with RNA from liver, a control tissue that does not express mGluR4, demonstrating the specificity and also detected. Clones of cells stably transfected with brain-mGluR4 RNase sensitivity of the probe. The known full-length form of showed prominent bands of the same size as in cerebellum (Fig. 3a). mGluR4 mRNA (henceforth designated ‘brain-mGluR4’) should In contrast, CHO cells transfected with the taste-mGluR4 construct protect a band of 178 nucleotides, as it includes no sequence from consistently showed a prominent band of ∼68 kDa, corresponding intron a. Indeed, consistent with an identity as brain-mGluR4, to the size predicted from the cDNA sequence. Neither the ∼102a protected band of ~180 nucleotides was detected in kDa nor ∼68-kDa bands was present in parallel lanes containing poly(A)RNA from cerebellum and, at a lower concentration, from lysates of CHO cells transfected with non-recombinant pcDNA taste papillae. In addition, we detected two bands corresponding vector. Thus, the truncated taste-mGluR4 mRNA characterized to precursor nuclear RNA when cerebellar poly(A)RNA was used from taste tissue was indeed a functional mRNA that was translatin RNase protection. Because exons N1 and N2 are not contiguous ed into immunologically recognizable protein. in the genome, precursor RNA protected fragments ~460 nucleotides long (400 nucleotides of intron a plus exon N1) and Taste-mGluR4 is negatively coupled to cAMP ~120 nucleotides (fragment of exon N2). The absence of these In transfected CHO cells, activation of group III mGluRs leads to a precursor bands in taste samples indicated that genomic DNA suppression of forskolin-stimulated cAMP synthesis35. CHO cells (which would protect the same size bands as precursor RNA) was stably expressing brain-mGluR4 responded predictably to L-glutanot a significant contaminant in the taste samples. mate (Fig. 3b). The EC50 for this response was 2 µM glutamate, conIn addition to bands derived from the known mGluR4 sistent with earlier reports on mGluR4a (5 µM)35. Cells expressing mRNA and its precursor RNA, hybridization with poly(A)RNA taste-mGluR4 displayed no response to L-glutamate at concentrafrom taste papillae yielded an additional band. This was a broad tions of 30 µM or below. The EC50 for L-glutamate for taste-mGluR4
© 2000 Nature America Inc. • http://neurosci.nature.com
a
116
b
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
taste. The cAMP levels in control cells transfected with nonrecombinant vector did not change upon treatment with L-AP4.
© 2000 Nature America Inc. • http://neurosci.nature.com
DISCUSSION
Fig. 4. Taste-mGluR4 is activated by L-AP4 at higher concentrations than is brain-mGluR4. CHO cells expressing brain-mGluR4 (solid bars) and taste-mGluR4 (shaded bars) were stimulated with the indicated concentrations of L-AP4. Six independent experiments were carried out (three each on clonal and non-clonal lines of stably transfected cells). For each concentration, triplicate wells of cells were used in each experiment. The values represent mean ± s.e.
was calculated to be 280 µM glutamate. We considered the possibility that a low cell-surface density of taste-mGluR4 might explain its low efficacy (high EC50). Thus, we examined two separate lines of CHO cells expressing taste-mGluR4. Expression levels of tastemGluR4 (as determined by immunoblot) were 100-fold and 2-fold lower, respectively, than in parallel lines expressing brain-mGluR4. Nevertheless, the EC50 values for the two lines expressing tastemGluR4 were very similar, 300 and 250 µM, respectively. The consistently high EC50 for taste-mGluR4 suggests that low receptor density does not explain its low efficacy. Instead, the data suggest that taste-mGluR4 is approximately two orders of magnitude less sensitive to L-glutamate than is brain-mGluR4. Direct measurements of affinity will be necessary to confirm this interpretation. Because the concentration of L-glutamate required for tastemGluR4 was high, we considered that osmotic or other nonspecific effects might influence the cAMP response. Thus, we stimulated mGluR4-expressing cells with D-glutamate, an isomer that does not elicit umami taste36. Relative to controls, cells stimulated with 1 mM D-glutamate yielded cAMP levels of 126 ± 17% (brain-mGluR4) or 99 ± 3% (taste-mGluR4). Control CHO cells transfected with non-recombinant vector did not alter cAMP concentrations upon treatment with either L- or D-glutamate. Thus, receptor-independent mechanisms do not seem to decrease cAMP. Taste-mGluR4 responds to L-AP4 In rat and human behavioral studies, L-AP4 mimics the taste of L-MSG17,22. Thus, we predicted that the taste receptor for L-MSG should also be stimulated by L-AP4. We directly tested whether taste-mGluR4 meets the criterion of a taste receptor by measuring its response to L-AP4 in a concentration range effective for taste. CHO cells expressing brain-mGluR4 responded to L-AP4 by suppressing forskolin-stimulated cAMP production. The response seemed to saturate at all concentrations of L-AP4 above 10 µM (Fig. 4), as expected from the published EC50 of 0.5–1.0 µM35. In cells expressing taste-mGluR4, 10 µM L-AP4 was ineffective, whereas 100 µM and 1 mM L-AP4 gave progressively larger responses. For rats in a behavioral assay, 100 µM L-AP4 is near the detection threshold17. Thus, taste-mGluR4 responds to L-AP4 over a concentration range similar to that observed for L-AP4 nature neuroscience • volume 3 no 2 • february 2000
MGluR4 is a metabotropic glutamate receptor originally characterized from the brain. In situ hybridization analyses have shown that this receptor is also expressed in taste buds17,21. The present report demonstrates that mGluR4 in taste tissue is expressed as a structurally and functionally distinct form that we have termed ‘taste-mGluR4’. Taste-mGluR4 is a truncated version of the previously characterized brain receptor, and lacks ∼50% of the receptor’s extracellular N terminus. This truncation is particularly significant, because the N terminus of metabotropic glutamate receptors is believed to contain the glutamate-binding domain29, and changes in this region are likely to influence the affinity of the receptor for ligands. Indeed, we report here that the truncated taste-mGluR4 is much less sensitive to L-glutamate and L-AP4 than the full-length brain form, implying a reduced affinity for these agonists. Importantly, the reduced sensitivity of taste-mGluR4 corresponds well with the concentrations of L-glutamate and L-AP4 needed to elicit a response in gustatory receptor cells in situ. The data are fully consistent with the interpretation that the novel taste-mGluR4 is a taste receptor for umami (the taste quality elicited by L-MSG). The molecular identification and characterization of taste receptors has lagged behind research on other sensory receptors, notably, receptors for vision and olfaction. GPCRs are present in taste tissue13,14; receptors with sequences related to those of the mGluRs15. Although mRNA and/or protein for such candidate taste receptors has been demonstrated in lingual tissue, the lack of functional expression has hampered ligand identification and validation of their physiological significance. One of the challenges for studying the function of taste receptors is the high concentrations of stimuli needed. In the case of sugars, salts, and glutamate, the detection thresholds of gustatory sensory cells in nerve recordings or behavioral tests are in the range of a few hundred micromolar and higher. The low sensitivity of taste receptors, which may result from low affinity for ligands, has complicated binding assays and functional tests. By utilizing a high concentration of glutamate and a selective glutamate receptor ligand (L-AP4), we have been able to characterize the function of taste-mGluR4 in transfected cells. The taste-mGluR4 cDNA in this report was cloned from posterior (circumvallate and foliate) taste papillae of juvenile rats. The threshold concentration for activating taste-mGluR4 (30 µM) matches well with the threshold (100 µM) reported for glutamate taste responses in the glossopharyngeal nerve of juvenile mice26. Interestingly, taste nerve thresholds in adult mice and rats, at 2–10 mM, are significantly higher26,27. In our studies, we found that the mRNA for taste-mGluR4 is expressed at lower concentration in adult than in juvenile rats17 (Fig. 2b), which may explain the decreased sensitivity to MSG taste in adult rodents. L-AP4 is a highly effective ligand at brain-mGluR4 (ref. 35). L-AP4 mimics the taste of glutamate in rats17 and is an umami stimulus in humans22. Here we show that L-AP4 also stimulates taste-mGluR4, at concentrations effective as taste stimuli. MAP4, an antagonist of brain-mGluR4, fails to block taste nerve responses to glutamate and L-AP4 in chorda tympani nerve recordings23. Tests of MAP4 on cloned taste-mGluR4 may help to resolve this seeming paradox. Given the drastically altered N terminus of taste-mGluR4, it is impossible to predict its response to the various glutamate analogs known to activate or antagonize brain-mGluR4. 117
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
A distinctive feature of umami is the potentiation of glutamate responses by the nucleotide monophosphates of inosine and guanosine (IMP and GMP). This synergy is well documented in human psychophysical studies37, animal behavioral experiments24, gustatory nerve recordings27 and patch-clamp studies25. Synergistic interactions are also found between L-AP4 and nucleotides23,24, further underscoring the importance of taste-mGluR4 to umami transduction. The site of interaction between glutamate and nucleotides remains to be defined, but might involve synaptic convergence of separate gustatory sensory cells onto common afferent fibers, or converging signaling pathways from separate receptors within the same glutamate-sensing taste bud cell. It is also possible that both glutamate and nucleotides interact with a common receptor molecule. For instance, ligand-binding studies on bovine taste membranes suggested an allosteric model for nucleotide effects on glutamate taste38. The cloned taste-mGluR4 will allow direct tests of such models of receptor-taste stimulus interactions. Our RT-PCR and RNase protection analyses indicate that both taste-mGluR4 and brain-mGluR4 are expressed in taste tissue (Fig. 2a and b). Glutamate is implicated as a neurotransmitter for taste bud afferent synapses39, and brain-mGluR4 could serve as an autoreceptor at such synapses. We suggest that taste-mGluR4 is likely to function as an umami receptor, whereas brain-mGluR4 may serve as a neurotransmitter receptor at synapses in or near taste papillae. Glutamate receptors other than mGluR4 may be expressed in gustatory sensory cells. For example, patch-clamp recordings, Co2+ uptake, and Ca2+ imaging on rat and mouse taste buds suggest that glutamate activates both ionotropic and metabotropic glutamate receptors18,25,39,40. However, all these experiments exposed both apical and basolateral membranes of taste receptor cells to glutamate. Given that bona-fide taste stimulation reaches only the apical membrane of taste receptor cells, it is critical to note that behavioral studies and nerve recordings (which stimulate only the apical membrane) indicate a minimal role for ionotropic-like glutamate receptors in taste transduction for L-MSG17,22–24. Thus, basolateral synapses on gustatory receptor cells may include glutamate receptors other than taste-mGluR4 (reviewed in ref. 20). Transcripts of several mGluRs, including mGluR1 and mGluR5, are alternatively spliced41,42. For mGluR4, alternative splicing gives rise to receptors with either long or short C termini32. In spite of considerable structural diversity, most alternative-splicing variants of mGluRs show only subtle changes in their functional properties. For instance, mGluR1c and mGluR1a elicit distinct temporal patterns of Ca2+ release42. The present case of taste-mGluR4 demonstrates substantially different function of two receptors derived from the same gene. We do not presently know the molecular mechanism by which the truncated mRNA is produced in taste cells. It is possible that an alternative splice acceptor site is located within intron a and that our 5′ RACE reactions did not progress into additional exons upstream of the ~60 bp in intron a. Nevertheless, the presence of an in-frame stop codon within these ∼60 nucleotides implies that any additional exons would constitute 5′ UTR of the mRNA and would not affect the sequence of the translated protein. An alternative possibility is that the origin for transcription of taste-mGluR4 mRNA is located within intron a. Multiple promoters yielding mRNAs with distinct 5′ exons occur in the mGluR5 gene43.
METHODS Tissues and RNA. All tissues were from Harlan Sprague-Dawley rats. Circumvallate and foliate taste papillae were dissected from tongue, and rapidly frozen on dry ice. Poly(A)mRNA was extracted from tissues by direct binding to oligo dT-cellulose (FastTrack II kit, Invitrogen, Carlsbad, California). Unless stated otherwise, taste tissue samples were from juvenile (pre-weaning 16–20 day-old) rats. 118
5′ and 3′-RACE and RT-PCR. Initial 5′ RACE (rapid amplification of cDNA ends) reactions were carried out using superscript reverse transcriptase followed by terminal deoxynucleotidyl transferase (both from Gibco-BRL, Gaithersburg, Maryland)44. Subsequently, the Marathon RACE system (Clontech Laboratories, Palo Alto, California) was employed for generating and cloning RACE products. Poly(A)RNA, extracted from vallate and foliate papilla, was used to synthesize double strand cDNA, which was then ligated to an adapter-primer. Nested genespecific primers were designed in the core region of rat mGluR4 cDNA sequence within the 800-bp region known to be expressed in taste buds17. RACE reactions in both directions were carried out using Klentaq DNA polymerase (Clontech) or Elongase (BRL) to ensure amplification of long products. Annealing steps were at the highest temperature permitted by respective primers. Amplification proceeded for 25–30 cycles to minimize nonspecific products. Amplification products were electrophoresed and blot hybridized to identify mGluR4-related bands, which were then cloned into pGEM-T vector (Promega) and sequenced on an ABI Sequencer Model 373A. The following primers based on mGluR4a cDNA33 (with identifying amino acid positions) were used in reverse transcriptase-polymerase chain reaction (RT-PCR): B: 5′ (D266) CGACAAGATCATCAAACTGCCTAC 3′ R: 5′ (F455) GAAGTTGACGTTCCTGATGTACT 3′ To isolate a genomic fragment that contained ‘intron a’, genomic DNA was amplified with primers located in cDNA sequence: forward primer B (above) and a reverse primer at F307–N301. The following primers were based on intron sequence derived from genomic clones, and were used to map whether the entire intron a was represented in precursor nuclear RNAs (Fig. 2a): T1: 5′ (48 bp upstream of R292) CAGCTGGGTAGCCTTACATGTCT 3′ T2: 5′ (400 bp upstream of R292) TCTGGAGTAGGATCAGGTGGATG 3′ T3: 5′ (2000 bp upstream of R292) AAAGGCTGCTATCTCGTGGACT 3′;. RNase protection assay. The template for mGluR4 probe was constructed by ligating together a genomic fragment and a cDNA fragment at a shared AflIII site located 32 bp upstream of the junction between intron a and exon N1 (Figs. 1b and 2b). The genomic fragment contained the downstream 400 bp of intron a (extended for 368 bp upstream of the AflIII site). The 210 bp cDNA segment of the chimeric probe began at the AflIII site in intron a and included two sequential exons, N1 and part of N2. The resulting construct in pGEM-T vector was used to transcribe an antisense probe (Fig. 2b) with at least 238 nt complementary to taste-mGluR4 mRNA, as predicted from the sequence of the longest 5′ RACE clone (see Results). [32P]labeled antisense RNA was transcribed using T7 RNA polymerase. Hybridization and RNase digestion were performed using the High-Speed Hybridization RPA kit from Ambion (Austin, Texas). Protected fragments were analyzed on denaturing 6% polyacrylamide-urea gels. Transfection. Full-length cDNAs for brain-mGluR4 and taste-mGluR4 (see Results) were reconstructed from cerebellar or taste poly(A)RNA respectively, by RT-PCR using Elongase (BRL) for high-fidelity amplification. The brain-mGluR4 insert included 7 nucleotides of 5′ untranslated region; the taste-mGluR4 insert included 100 nucleotides of presumed 5′ UTR upstream of the first in-frame start codon. Both cDNA inserts terminated at their common stop codon (following I912), yielding the mGluR4a version of the C terminus33. The inserts were cloned into the EcoRI site of pcDNA3.1 vector (Invitrogen). CHO cells were transfected with brain-mGluR4 and taste-mGluR4 constructs and with non-recombinant pcDNA3.1 vector, all in parallel, using a cationic lipid, DMRIE-C (Gibco-BRL). Cells with stably integrated plasmid were selected and maintained in 300 µg per ml G418 starting 24 h after transfection. The medium consisted of Dulbecco’s Modified Eagle Medium (D-MEM) supplemented with 10% fetal bovine serum, 2 mM glutamine, 1.7 mM proline and 100 units per ml penicillin-streptomycin35. Clones were lifted within two weeks and screened for expression by western blot analysis. A single clone for each form was propagated for functional assays. Stably transfected but non-clonal lines of cells from independent transfections with both forms of mGluR4 and non-recombinant vector were also maintained and used in functional assays. nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
Immunoblot analysis. Anti-peptide anti-serum directed against the Cterminal 18-amino-acid sequence of mGluR4a was raised in rabbits and antibody was purified by affinity chromatography (Zymed Laboratories, San Francisco, California). This epitope is shared between both brainmGluR4 and taste-mGluR4 described here. Lysates of transfected CHO cells were electrophoresed and tested for expression of brain- and tastemGluR4 by immunoblot analysis45 on PVDF membrane. Detection was with alkaline phosphatase-conjugated secondary antibody and CSPD chemiluminescent substrate (both from Tropix, Bedford, Massachusetts). Bands on autoradiographs were densitometrically quantified as needed. Functional assay. CHO cells, stably transfected with brain-mGluR4, tastemGluR4 or non-recombinant pcDNA3.1, were maintained as sub-confluent cultures and refed every two days to minimize chronic stimulation of expressed receptors by glutamate released from dead cells. Cells were plated 20 h before assay in a 96-well microtiter plate at 2 × 104 cells per 200 µl well. Fresh medium was replaced for one hour immediately before assaying receptor function as described35. Briefly, cells were incubated in Dulbecco’s phosphate buffered saline containing 1 mM IBMX for 20 min followed by stimulation for 10 min in 10 µM forskolin and 1 mM IBMX, with or without agonists. Stimulation buffer was rapidly removed, and cells were lysed in 200 µl 0.25% dodecyltrimethyl-ammonium bromide in 50 mM acetate buffer (Amersham, Piscataway, New Jersey). Released cAMP in 20% of each lysate was assayed directly using an Amersham EIAbased kit and plotted as mean ± s.e. of 3–6 experiments, each performed with triplicate wells of cells.
ACKNOWLEDGEMENTS This work was supported by grants from NIH/NIDCD (DC 03013) and from Cultor Food Science, Inc. We are also grateful for support from the Umami Manufacturers’ Association of Japan during the early stages of this study. We acknowledge technical assistance from Cynthia Lamp and Helena de Carvalho.
RECEIVED 20 SEPTEMBER; ACCEPTED 14 DECEMBER 1999 1. Lindemann, B. Taste reception. Physiol. Rev. 76, 719–766 (1996). 2. Lindemann, B. Receptor seeks ligand: on the way to cloning the molecular receptors for sweet and bitter taste. Nat. Med. 5, 381–382 (1999). 3. McLaughlin, S. K., McKinnon, P. J. & Margolskee, R. F. Gustducin is a tastecell-specific G protein closely related to the transducins. Nature 357, 563–569 (1992). 4. McLaughlin, S. K., McKinnon, P. J., Spickofsky, N., Danho, W. & Margolskee, R. F. Molecular cloning of G proteins and phosphodiesterases from rat taste cells. Physiol. Behav. 56, 1157–1164 (1994). 5. Kusakabe, Y., Abe, K., Tanemura, K., Emori, Y. & Arai, S. GUST27 and closely related G-protein-coupled receptors are localized in taste buds together with Gi-protein α-subunit. Chem. Senses 21, 335–340 (1996). 6. Kusakabe, Y. et al. Identification of two alpha-subunit species of GTP-binding proteins, Ga15 and Gaq, expressed in rat taste buds. Biochim. Biophys. Acta 1403, 265–272 (1998). 7. Huang, L. et al. Gγ13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium. Nat. Neurosci. 2, 1055–1062 (1999). 8. Misaka, T. et al. Taste buds have a cyclic nucleotide-activated channel, CNGgust. J. Biol. Chem. 272, 22623–22629 (1997). 9. Kretz, O., Barbry, P., Bock, R. & Lindemann, B. Differential expression of RNA and protein of the three pore-forming subunits of the amiloridesensitive epithelial sodium channel in taste buds of the rat. J. Histochem. Cytochem. 47, 51–64 (1999). 10. Lin, W., Finger, T. E., Rossier, B. C. & Kinnamon, S. C. Epithelial Na+ channel subunits in rat taste cells: localization and regulation by aldosterone. J. Comp. Neurol. 405, 406–420 (1999). 11. Ogawa, S. et al. Receptor that leaves a sour taste in the mouth. Nature 395, 555–556 (1998). 12. Ming, D., Ruiz-Avila, L. & Margolskee, R. F. Characterization and solubilization of bitter-responsive receptors that couple to gustducin. Proc. Natl. Acad. Sci. USA 95, 8933–8938 (1998). 13. Matsuoka, I., Mori, T., Aoki, J., Sato, T. & Kurihara, K. Identification of novel members of G-protein coupled receptor superfamily expressed in bovine taste tissue. Biochem. Biophys. Res. Commun. 194, 504–511 (1993). 14. Abe, K., Kusakabe, Y., Tanemura, K., Emori, Y. & Arai, S. Primary structure and cell-type specific expression of a gustatory G protein-coupled receptor related to olfactory receptors. J. Biol. Chem. 268, 12033–12039 (1993). 15. Hoon, M. A. et al. Putative mammalian taste receptors: a class of taste-specific GPCRs with distinct topographic selectivity. Cell 96, 541–551 (1999).
nature neuroscience • volume 3 no 2 • february 2000
16. Faurion, A. Are umami taste receptor sites structurally related to glutamate CNS receptor sites? Physiol. Behav. 49, 905–912 (1991). 17. Chaudhari, N. et al. The taste of monosodium glutamate: Membrane receptors in taste buds. J. Neurosci. 16, 3817–3826 (1996). 18. Hayashi, Y., Zviman, M. M., Brand, J. G., Teeter, J. H. & Restrepo, D. Measurement of membrane potential and [Ca2+ ]i in cell ensembles: Application to the study of glutamate taste in mice. Biophys. J. 71, 1057–1070 (1996). 19. Conn, P. J. & Pin, J. P. Pharmacology and functions of metabotropic glutamate receptors. Annu. Rev. Pharmacol. Toxicol. 37, 205–237 (1997). 20. Chaudhari, N. & Roper, S. D. Molecular and physiological evidence for glutamate (umami) taste transduction via a G protein-coupled receptor. Ann. NY Acad. Sci. 855, 398–406 (1998). 21. Yang, H., Wanner, I. B., Roper, S. D. & Chaudhari, N. An optimized method for in situ hybridization with signal amplification that allows the detection of rare mRNAs. J. Histochem. Cytochem. 47 431–446 (1999). 22. Kurihara, K. & Kashiwayanagi, M. Introductory remarks on umami taste. Ann. NY Acad. Sci. 855, 393–397 (1998). 23. Sako, N. & Yamamoto, T. Analyses of taste nerve responses with special reference to possible receptor mechanisms of umami taste in the rat. Neurosci. Lett. 261, 109–112 (1999). 24. Delay, E. R. et al. Taste preference synergism between glutamate receptor ligands and IMP in rats. Chem. Senses (in press). 25. Lin, W. & Kinnamon, S.C. Physiological evidence for ionotropic and metabotropic glutamate receptors in rat taste cells. J. Neurophysiol. 82, 2061–2069 (1999). 26. Ninomiya, Y., Tanikukai, T., Yoshida, S., Funakoshi, M. & Tanimukai, T. Gustatory neural responses in preweanling mice. Physiol. Behav. 49, 913–918 (1991). 27. Yamamoto, T. et al. Electrophysiological and behavioural studies on the taste of umami substances in the rat. Physiol. Behav. 49, 919–925 (1991). 28. Monastyrskaia, K. et al. Effect of the umami peptides on the ligand binding and function of rat mGlu4a receptor might implicate this receptor in the monosodium glutamate taste transduction. Br. J. Pharmacol. 128, 1027–1034 (1999). 29. O’Hara, P. J. et al. The ligand-binding domain in metabotropic glutamate receptors is related to bacterial periplasmic binding proteins. Neuron 11, 41–52 (1993). 30. Han, G. & Hampson, D. R. Ligand binding to the amino-terminal domain of the mGluR4 subtype of metabotropic glutamate receptor. J. Biol. Chem. 274, 10008–10013 (1999). 31. Takahashi, K., Tsuchida, K., Tanabe, Y., Masu, M. & Nakanishi, S. Role of the large extracellular domain of metabotropic glutamate receptors in agonist selectivity determination. J. Biol. Chem. 268, 19341–19345 (1993). 32. Thomsen, C. et al. Cloning and characterization of a metabotropic glutamate receptor, mGluR4b. Neuropharmacology 36, 21–30 (1997). 33. Tanabe, Y., Masu, M., Ishii, T., Shigemoto, R. & Nakanishi, S. A family of metabotropic glutamate receptors. Neuron 8, 169–179 (1992). 34. Bradley, S. R., Levey, A. I., Hersch, S. M. & Conn, P. J. Immunocytochemical localization of group III metabotropic glutamate receptors in the hippocampus with subtype-specific antibodies. J. Neurosci. 16, 2044–2056 (1996). 35. Tanabe, Y. et al. Signal transduction, pharmacological properties and expression patterns of two rat metabotropic glutamate receptors, mGluR3 and mGluR4. J. Neurosci. 13, 1372–1378 (1993). 36. Hettinger, T. P., Frank, M. E. & Myers, W. E. Are the tastes of polycose and monosodium glutamate unique? Chem. Senses 21, 341–347 (1996). 37. Rifkin, B. & Bartoshuk, L.M. Taste synergism between monosodium glutamate and disodium 5′-guanylate. Physiol. Behav. 24, 1169–1172 (1980). 38. Torii, K. & Cagan, R. H. Biochemical studies of taste sensation. IX. Enhancement of L-[3H]glutamate binding to bovine taste papillae by 5′-ribonucleotides. Biochim. Biophys. Acta 627, 313–323 (1980). 39. Caicedo, A., Kim, K. & Roper, S. Glutamate-induced cobalt uptake reveals non-NMDA receptors in rat taste cells. J. Comp. Neurol. (in press). 40. Bigiani, A., Delay, R. J., Chaudhari, N., Kinnamon, S. C. & Roper, S. D. Responses to glutamate in rat taste cells. J. Neurophysiol. 77, 3048–3059 (1997). 41. Pin, J. P. & Duvoisin, R. The metabotropic glutamate receptors: structure and functions. Neuropharmacology 34, 1–26 (1995). 42. Pin, J.-P., Waeber, C., Prezeau, L., Bockaert, J. & Heinemann, S. F. Alternative splicing generates metabotropic glutamate receptors inducing different patterns of calcium release in Xenopus oocytes. Proc. Natl. Acad. Sci. USA 89, 10331–10335 (1992). 43. Yamaguchi, S. & Nakanishi, S. Regional expression and regulation of alternative forms of mRNAs derived from two distinct transcription initiation sites of the rat mGluR5 gene. J. Neurochem. 71, 60–68 (1998). 44. Frohman, M. A., Dush, M. K. & Martin, G. R. Rapid production of fulllength cDNAs from rare transcripts: amplification using a single genespecific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002 (1988). 45. Towbin, H., Staehelin, T. & Bordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350–4354 (1979).
119
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Identification and characterization of the high-affinity choline transporter
© 2000 Nature America Inc. • http://neurosci.nature.com
Takashi Okuda1, Tatsuya Haga1, Yoshikatsu Kanai2,3, Hitoshi Endou2, Takeshi Ishihara4 and Isao Katsura4 1
Department of Neurochemistry, Faculty of Medicine, University of Tokyo and CREST of Japan Science and Technology Corporation, Bunkyo-ku, Tokyo 113-0033, Japan
2
Department of Pharmacology and Toxicology, Kyorin University School of Medicine, Mitaka, Tokyo 181-8611, Japan
3
PRESTO of Japan Science and Technology Corporation, Mitaka, Tokyo 181-8611, Japan
4
Structural Biology Center, National Institute of Genetics and Department of Genetics, School of Life Science, Graduate University for Advanced Studies, Mishima 411-8540, Japan Correspondence should be addressed to T.O. (
[email protected])
In cholinergic neurons, high-affinity choline uptake in presynaptic terminals is the rate-limiting step in acetylcholine synthesis. Using information provided by the Caenorhabditis elegans Genome Project, we cloned a cDNA encoding the high-affinity choline transporter from C. elegans (cho-1). We subsequently used this clone to isolate the corresponding cDNA from rat (CHT1). CHT1 is not homologous to neurotransmitter transporters, but is homologous to members of the Na+-dependent glucose transporter family. Expression of CHT1 mRNA is restricted to cholinergic neurons. The characteristics of CHT1-mediated choline uptake essentially match those of high-affinity choline uptake in rat brain synaptosomes.
Cholinergic neurons are vital for cognitive functions of the brain1,2 and are known to be vulnerable in Alzheimer’s disease3. Because cholinergic neurons lack the capacity to synthesize choline de novo, their function depends upon choline uptake4. Brain synaptosome studies demonstrate two carrier-mediated transport systems for choline uptake5–9. At high concentrations, choline is transported primarily by a low-affinity and Na+-independent system that is inhibited by hemicholinium-3 (HC3)10 with a high Ki of approximately 50 µM. This system is thought to be ubiquitously present in cells and to be required for phosphatidylcholine synthesis. At low concentrations, choline is transported by a high-affinity, Na+-dependent system that is inhibited by HC3 with a low Ki of 10–100 nM. The high-affinity system is supposed to be present specifically in cholinergic neurons, because a substantial proportion of choline is converted to acetylcholine only when taken up through the high-affinity system5,7,8. The proposal that the high-affinity choline transport system is unique to cholinergic neurons is supported by the selective loss of the high-affinity choline uptake following depletion of cholinergic terminals in a variety of denervation studies8,9. Choline uptake is generally believed to be the rate-limiting step in acetylcholine synthesis4–9. In addition, the high-affinity choline uptake is regulated by neuronal activity11,12, suggesting that neuronal activity also regulates acetylcholine synthesis. In Alzheimer’s disease, cholinergic neurons selectively degenerate. Consistent with the above hypothesis, the high-affinity choline transporter is reduced in Alzheimer’s disease13. On the other hand, some reports suggest upregulation of the high-affinity choline transporter or [3H]HC3-binding sites in Alzheimer’s disease14. 120
Although complementary DNAs for transporters for major neurotransmitters such as GABA, noradrenaline, dopamine, serotonin, glycine and glutamate have been isolated 15, the cDNA encoding the high-affinity choline transporter remains to be isolated despite its physiological importance. Moreover, the cDNAs encoding cholinergic neuronal markers, choline acetyltransferase16 and the vesicular acetylcholine transporter17 have been isolated. Here we report the functional identification and characterization of a cDNA encoding the high-affinity choline transporter (cho-1) in the nematode Caenorhabditis elegans. We also describe the isolation and characterization of the rat homolog of cho-1, designated CHT1. Identification of this high-affinity choline-transporter molecule may further understanding of cholinergic neurons and suggest new therapeutic strategies to counter cholinergic-selective neurodegenerative disorders such as Alzheimer’s disease3,14,18.
RESULTS To isolate the cDNA encoding the high-affinity choline transporter, we examined cDNAs predicted by sequences from the C. elegans Genome Project19 to be members of the Na+-dependent transporter family. Xenopus laevis oocytes were injected with cRNA prepared from each candidate full-length clone and examined for induction of high-affinity choline uptake. We used inhibition by 1 µM hemicholinium-3 (HC3) as the criteria for high-affinity choline uptake, because this uptake in mammalian brain synaptosomes is completely inhibited by 1 µM HC3 (K i = 10–100 nM) 7,8,10. By contrast, the low-affinity choline uptake, which is ubiquitously distributed, is inhibited only at nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
b
c
Choline uptake (cpm)
a
Water
C48D1.3
Water
C48D1.3
© 2000 Nature America Inc. • http://neurosci.nature.com
d
higher concentrations of HC3 (Ki of approximately 50 µM). One cDNA clone corresponding to the predicted gene C48D1.3 induced a small but significant choline uptake that was inhibited by 1 µM HC3 (Fig. 1a). This HC3-sensitive uptake was Na + dependent, and the apparent Ki for HC3 was estimated to be 50 nM (Fig. 1b and c). Hence we designated this clone cho-1 (highaffinity choline transporter-1). A comparison of the cDNA and the genomic sequence indicates that the cho-1 gene is composed of nine exons (data not shown). The cho-1 cDNA sequence predicts a protein of 576 amino acids (Fig. 2a). A search of available databases with the amino-acid sequence revealed weak but significant homology with members of the Na+-dependent glucose transporter family20 (Fig. 2b). Analysis of hydrophobicity and comparison with other transporters suggests a topological configuration containing twelve transmembrane regions (Fig. 2c). To identify the cells that express cho-1, we introduced the green fluorescent protein (GFP) gene linked to the 5.1-kb upstream region of cho-1 gene into worms. Expression of GFP was detected in the nervous system, including the nerve ring and cholinergic motor neurons of the ventral nerve cord, supporting the idea that cho-1 encodes the high-affinity choline transporter in cholinergic neurons (Fig. 1d). We next focused on the vertebrate homolog of cho-1. A database search using the predicted amino-acid sequence of cho-1 identified an entry (GenBank accession number AQ316435) in the human genomic survey sequence (GSS). Based on the sequence homology between cho-1 and this human genomic clone, we amplified a cDNA fragment from the rat spinal cord cDNA using degenerate PCR primers. This fragment was used to screen a rat spinal cDNA library and to isolate positive clones. The sequence of the longest open reading frame predicted a protein of 580 amino nature neuroscience • volume 3 no 2 • february 2000
–log[HC3] (M)
Fig. 1. Identification, expression and localization of C. elegans cho-1. (a) [3H]choline uptake in Xenopus oocytes injected with C48D1.3 cRNA or water. Black and gray bars indicate choline uptake values in the absence and presence of 1 µM hemicholinium-3 (HC3), respectively. Each bar represents the mean ± s.e. (n = 6–8 oocytes). (b) Effects of Na+ on choline uptake. Black bars indicate choline uptake measured in the standard medium ([Na+] = 100 mM); gray bars indicate uptake in the absence of Na+. (Na+ was replaced by Li+.) (c) Inhibition of choline uptake by HC3. (d) Distribution of neurons that express cho1::gfp in the nervous system in C. elegans. An image of a L1 larvae of N2 carrying an extrachromosomal array of cho-1::gfp reporter constructs. The arrowhead indicates the nerve ring. In the ventral nerve cord, GFP is expressed only in the cholinergic motor neurons. However, some DA and DB neurons do not express GFP, probably because of the loss of the extrachromosomal array. Scale bar, 50 µm.
acids with 51% identity and 70% similarity to cho-1 (Fig. 2a). The rat cDNA clone was designated CHT1. The amino-acid sequence of CHT1 has significant homology with members of the family of Na+-dependent glucose transporters20 (20–25%; Fig. 2b), but no significant homology with those of the choline transporter of yeast21, the mammalian creatine transporter originally identified as a high-affinity choline transporter22 or any known neurotransmitter transporters15. The topological model predicted for CHT1 is essentially the same as that of C. elegans CHO-1 (Fig. 2c). Expression of CHT1 mRNA was examined by Northern blots and in–situ hybridization. Northern blots of various rat tissues for CHT1 mRNA showed expression of ∼5-kb transcripts (Fig. 3a). High mRNA expression was observed in basal forebrain, brainstem and spinal cord, and low expression was seen in striatum. Each of these regions contains cholinergic neurons. In contrast, no transcripts were detected in other areas of brain or the non-neuronal tissues examined. Consistent with the Northern blots, in–situ hybridization demonstrated expression of CHT1 mRNA in major cholinergic cell groups examined, including the striatum, ventral spinal cord and scattered cell groups in the basal forebrain (Fig. 3b and c). This distribution was virtually identical to those for choline acetyltransferase23 and vesicular acetylcholine transporter24 mRNA, indicating that CHT1 mRNA was expressed exclusively in cholinergic neurons. Choline uptake in Xenopus oocytes injected with CHT1 cRNA was two- to fourfold greater than the background uptake in control oocytes injected with water (Fig. 4a). Choline uptake mediated by CHT1 saturated with increasing concentrations of choline with a Km of 2.2 ± 0.2 µM (n = 3; Fig. 4b). The apparent Km of choline for endogenous uptake in control oocytes was greater than 10 µM (data not shown). Choline uptake mediated by CHT1 was completely inhibited by less than 0.1 µM HC3 with a Ki of 2–5 nM (Fig. 4c). By contrast, choline uptake was only slightly inhibited by 10 µM HC3 in control oocytes. Examination of the ionic dependency of CHT1-mediated choline uptake revealed that the uptake is not only Na+ dependent, but also Cl– dependent (Fig. 4d). These results show that CHT1-mediated choline uptake had the expected characteristics of the high-affinity choline uptake in mammalian synaptosomes studies5–8 (high 121
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
a
b
c
Fig. 2. Deduced amino-acid sequence and topological model for the high-affinity choline transporter. (a) Alignment of the predicted aminoacid sequence of rat CHT1 and C. elegans CHO-1. Numbers in the right column correspond to amino-acid residues. Identical residues are in bold. The putative transmembrane domains I–XII are underlined. (b) Phylogenetic tree of Na+-dependent glucose transporter family. The tree was constructed by the neighbor-joining method37 using the CLUSTALW program of National Institute of Genetics (Mishima, Japan). The percent amino-acid identity between rat CHT1 and related proteins is shown to the right. Abbreviations: rbSNST1, rabbit sodium/nucleoside cotransporter 1 (SwissProt accession number P26430); rSGLT1, rat sodium/glucose cotransporter 1 (P53790); hSMIT1, human sodium/myoinositol cotransporter 1 (P53794); putP, E. coli sodium/proline symporter (P07117); panF, E. coli sodium/pantothenate symporter (P16256); rNIS, rat Na/I symporter (PIR accession number S68513); rSMVT, rat Na+-dependent vitamin transporter (PRF accession number 2413365A). (c) Predicted topology of rat CHT1 in the membrane. Circles represent individual amino acids. Filled circles indicate residues identical (black) or highly conserved (gray) with C. elegans CHO-1, and open circles indicate divergent residues. Branched lines indicate potential N-linked glycosylation sites. Circled P indicates consensus site for protein kinase C phosphorylation.
affinity for choline, high sensitivity to HC3 and dependence on Na+ and Cl– ions). We also examined [3H]HC3 binding activity of membranes prepared from COS7 cells, which were transfected with CHT1 cDNA or vector only (control). Na +-dependent binding of [3H]HC3 was detected in membranes from CHT1-transfected cells but not in membranes from control cells. (Fig. 5a). The equilibrium dissociation constant (Kd) was estimated to be 1.6 ± 0.2 nM (n = 3; Fig. 5b), which is similar to the values reported for brain synaptosomes10,25,26. Specific binding of [3H]HC3 was displaced by tenfold lower concentrations of choline than of acetylcholine (Fig. 5c). These results indicate that CHT1 is not only a high-affinity choline transporter, but also a HC3 binding site.
DISCUSSION In this study, we identified and characterized cDNAs encoding high-affinity choline transporters in C. elegans and rat, and we confirmed that the CHT1 has the same characteristics as the 122
transporter found in cholinergic nerve endings. We isolated the cDNA clone for the high-affinity choline transporter by using information provided by the C. elegans Genome Project19 and systematically expressing putative transporters one by one in Xenopus oocytes. We then extended this use of C. elegans genomic sequences to isolate a mammalian homolog. A similar strategy may be applicable to expression cloning of unidentified cDNAs of biological importance. Our results may explain why the high-affinity choline transporter was not previously cloned. First, CHT1 has no significant homology with members of neurotransmitter transporter family, precluding the use of homology-based cloning to obtain CHT1 cDNA. CHT1 is not expected to belong to the Na+-dependent glucose transporter family because the Na+-dependent glucose transporter depends on Na+ but not Cl– ions20, whereas the high-affinity choline uptake in synaptosomes as well as other neurotransmitter transporters depends on both Na+ and Cl– ions27. Second, the transport rate by CHT1 is not very high compared with the rates nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
b
Fig. 3. Expression studies of rat CHT1. (a) Northern analysis of CHT1 mRNA transcripts in rat tissues. The size of standards (0.24–9.5 kb) are shown on the left. (b, c) In–situ hybridization of CHT1 transcripts in rat brain and spinal cord. Bright-field micrographs of cryosections hybridized to digoxigenin-labeled antisense cRNA probe. CHT1 mRNA transcripts were detected in the vertical and horizontal limbs of the diagonal band (VDB, HDB), medial septal nucleus (MS), caudate and putamen (CPu) and olfactory tubercle (Tu; b). In the spinal cord, expression was detected in the ventral horn (VH; c). Adjacent sections hybridized with a probe for the vesicular acetylcholine transporter showed essentially the same pattern (data not shown). Sense probe yielded no signal. Scale bars, 1 mm.
of the high-capacity, low-affinity transporters present in Xenopus oocytes or cultured cells, possibly explaining previous failures to detect the transporter by expression cloning. Choline acetyltransferase (ChAT) and vesicular acetylcholine transporter (VAChT) are two proteins identified as markers for cholinergic neurons. Their genes are present at the same locus, with the VAChT gene positioned within the first intron of the ChAT gene, and their expression is regulated by the same promoter28,29. We identified CHT1 as a third marker protein for
c
cholinergic neurons. The human CHT1 gene, however, occurred at a locus different from the one for ChAT and VAChT (data not shown). It will be interesting to determine the similarities of the CHT1 promoter region and CHT1 mRNA distribution to those for ChAT and VAChT. Earlier studies using mammalian synaptosomes show that choline taken up through the high-affinity uptake system is efficiently converted to acetylcholine, although choline taken up through the low-affinity system is not significantly converted to
b
c
CHT1
[Choline] (µM)
Fig. 4. Functional expression of rat CHT1 in Xenopus oocytes. (a) [3H]choline uptake into Xenopus oocytes injected with CHT1 cRNA or water. Black and gray bars indicate choline uptake measured in standard medium containing 100 mM NaCl or LiCl, respectively. Each bar represents the mean ± s.e. (n = 6–8 oocytes). (b) Effect of choline concentrations on CHT1mediated choline uptake. The uptake in water-injected oocytes was subtracted from that in cRNA-injected oocytes, yielding CHT1-mediated choline uptake. The uptake was fitted to the Michaelis-Menten curve. (c) Inhibition of choline uptake by hemicholinium-3 (HC3). (d) Na+ and Cl– dependence of choline uptake. Gray and black bars indicate choline uptake into water- or cRNAinjected oocytes, respectively. NaCl (100 mM) in the standard uptake solution was replaced by equimolar amounts of the indicated salts. nature neuroscience • volume 3 no 2 • february 2000
–log[HC3] (M)
d Choline uptake (pmol/oocyte/30 min)
Water
Choline uptake (fmol/oocyte/30 min)
CHT1-mediated choline uptake (pmol/oocyte/30 min)
a [3H]Choline uptake (pmol/oocyte/30 min)
© 2000 Nature America Inc. • http://neurosci.nature.com
a
NaCl LiCl
KCl RbCl NaBr NaF Nal
123
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Specific [3H]HC3 binding (%)
[3H]HC3 binding (fmol/mg protein)
pcDNA pcDNACHT1
c
Specific Z[3H]HC3 binding (fmol/mg protein)
b
a
Free [3H]HC3 (nM)
–log[Competitor] (M)
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 5. Functional expression of rat CHT1 in COS7 cells. (a) Binding of [3H]HC3 to membranes prepared from COS7 cells transfected with CHT1 cDNA or vector (pcDNA3.1) only. (b) Saturation analysis of specific [3H]HC3 binding. (c) Displacement of specific [3H]HC3 binding by HC3, choline (Cho) and acetylcholine (ACh). Acetylcholine was tested in the presence of 1 µM physostigmine.
acetylcholine5,7,8. These findings suggest a close relationship between high-affinity choline uptake and acetylcholine synthesis30. The cloning of CHT1 provides a means to directly examine if and how CHT1 and ChAT interact. Cholinergic neurons are crucial in learning and memory1,2, and cholinergic deficits are correlated with the severity of dementia3. High-affinity choline uptake is the rate-limiting step in acetylcholine synthesis, and its activity is regulated by neuronal activity11,12 and other stimuli31–33. Furthermore, highaffinity choline uptake or HC3 binding are upregulated in Alzheimer’s disease14. The cloning of CHT1 may be important in discovering the molecular mechanisms underlying these regulations and in developing new therapeutic strategies for treating Alzheimer’s disease.
METHODS Cloning of transporter cDNAs. Candidate cDNAs for the choline transporter were isolated by reverse transcription-PCR from mixed-stage poly(A)+ RNA, using MarathonTM cDNA Amplification Kit (Clontech, Palo Alto, California), following the manufacturer’s protocols. PCR oligonucleotide forward primers based on DNA sequences obtained from the C. elegans Genome Project19 were designed to construct putative translation-initiation sites of the predicted genes. These amplified products were cloned into the Nco I (filled-in) and Not I sites of modified pSPUTK (Strategene, La Jolla, California), and the sequences of the inserted DNA were determined. Sequence data reported in this paper will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases with the accession numbers AB030946, AB030947. The rat CHT1 cDNA was isolated from a rat spinal cord cDNA library using the GeneTrapper cDNA Positive Selection System (Gibco BRL, Life Technologies, Rockville, Maryland) and a primer based on the sequence of the cDNA fragment, following the manufacturer’s protocols. After characterizing the resulting cDNA clones, we subcloned a positive clone into pSPUTK and pcDNA3.1+ (Invitrogen, Carlsbad, California). Expression in Xenopus oocytes. SP6 or T7 RNA polymerase in the presence of cap analog was used to prepare cRNA in vitro. Stage V–VI Xenopus laevis oocytes were injected with 20–30 ng capped cRNA. The uptake was assayed essentially as described34. Choline uptake (2–3 d after injection) was measured by incubating 6–8 oocytes for 30–45 min with [3H]choline chloride in 750 µl standard medium (100 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM HEPES, 5 mM Tris, pH 7.4). Oocytes were solubilized with 10% SDS, and the [3H] content was measured by liquid scintillation counting. GFP expression construct. The cho-1::gfp transcriptional fusion was constructed by PCR essentially as described35. The green fluorescent protein gene preceded by a nuclear localization signal (NLS) sequence was inserted in-frame, 3 amino acids downstream of the cho-1 translation start 124
site. NLS and gfp sequences were amplified from pPD104.53 (provided by A. Fire). To prepare the 5.1-kb region upstream from the cho-1 translation initiation site, we used a PCR primer that was designed to include the in-frame third amino-acid codons of cho-1. The rol-6 (su1006) marker and the constructed DNA were co-injected into the gonads of animals as described36. Northern analysis. Poly(A)+RNA (6 µg) prepared from different rat tissues was resolved by formaldehyde-agarose gel electrophoresis, transferred onto nylon membranes and hybridized to a random-primed [32P]-labeled cDNA fragment of CHT1 for 16 h at 42°C in 50% formamide, 5 × SSPE, 5 × Denhardt’s solution, 0.5% SDS and 100 µg per ml salmon sperm DNA. The filters were washed to a final stringency of 0.1 × SSPE, 0.1% SDS at 65°C and exposed to film with an enhancing screen for 7 days. In–situ hybridization. Digoxigenin-labeled antisense transcripts were synthesized in vitro. Transcripts were alkali-hydrolyzed to an average length of 200–400 base pairs and hybridized in situ on cryostat sections (10–20 µm) of fresh-frozen tissues. For hybridization, sections were incubated at 45°C for 20 h with the labeled cRNA probes (∼1 µg per ml) dissolved in 1× Denhardt’s solution containing 50 mM Tris-HCl (pH 8.0), 2.5 mM EDTA, 0.3 M NaCl, 50% formamide, 10% dextran sulphate and 1 mg per ml E. coli tRNA. Sections were then washed twice in 2× SSC/50% formamide and once in 1× SSC/50% formamide at 45°C. The hybridized probes were visualized using anti-digoxigenin Fab fragments (Boehringer Mannheim, Mannheim, Germany) and NBT/BCIP substrate. Sections were developed in substrate solution for 24–48 h. Binding assays. [3H]hemicholinium-3 (HC3; 128 Ci per mmol) was purchased from NEN Life Science Products (Boston, Massachusetts). COS7 cells were transiently transfected with pcDNA3.1-CHT1 or pcDNA3.1 using TransFast Reagent (Promega, Madison, Wisconsin) and following the manufacturer’s protocols. To prepare membranes, cells were homogenized in 0.32 M sucrose and centrifuged for 1 h at 200,000 g, and the pellet was resuspended. Binding assays were done essentially as described 26. Specific binding was calculated by subtracting non-specific binding (determined in the presence of 10 µM HC3) from total binding. Binding-saturation data were analyzed by nonlinear transformation of the calculated specific [3H]HC3 binding to generate a Kd value.
ACKNOWLEDGEMENTS We thank Y. Iino for the C. elegans N2 strain, Y. Kobayashi for help with basal forebrain preparations, A. Fire for pPD104.53, S. Yamashita for yeast cholinetransporter cDNA, T. Suzuki and Y. Kirino for Torpedo electric lobe and its cDNA library, Y. Koyama for laterodorsal tegmental nucleus, K. Kameyama for suggestions and D. Saffen for English corrections. This work was supported by grants from Japan Science and Technology Corporation (CREST) and the Ministry of Japan Society for the Promotion of Science (Research for Future Program).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
RECEIVED 1 NOVEMBER; ACCEPTED 23 NOVEMBER 1999 1. Winkler, J. et al. Essential role of neocortical acetylcholine in spatial memory. Nature 375, 484–487 (1995). 2. Dutar, P., Bassant, M. H., Senut, M. C. & Lamour, Y. The septohippocampal pathway: structure and function of a central cholinergic system. Physiol. Rev. 75, 393–427 (1995). 3. Bierer, L. M. et al. Neurochemical correlates of dementia severity in Alzheimer’s disease: relative importance of the cholinergic deficits. J. Neurochem. 64, 749–760 (1995). 4. Tucek, S. Regulation of acetylcholine synthesis in the brain. J. Neurochem. 44, 11–24 (1985). 5. Haga, T. Synthesis and release of [14C]acetylcholine in synaptosomes. J. Neurochem. 18, 781–798 (1971). 6. Yamamura, H. I. & Snyder, S. H. Choline: high-affinity uptake by rat brain synaptosomes. Science 178, 626–628 (1972). 7. Haga, T. & Noda, H. Choline uptake systems of rat brain synaptosomes. Biochim. Biophys. Acta 291, 564–575 (1973). 8. Kuhar, M. J. & Murrin, L. C. Sodium-dependent, high-affinity choline uptake. J. Neurochem. 30, 15–21 (1978). 9. Kuhar, M. J., Sethy, V. H., Roth, R. H. & Aghajanian, G. K. Choline: selective accumulation by central cholinergic neurons. J. Neurochem. 20, 581–593 (1973). 10. Happe, H. K. & Murrin, L. C. High-affinity choline transport sites: use of [3H]hemicholinium-3 as a quantitative marker. J. Neurochem. 60, 1191–1201 (1993). 11. Simon, J. R. & Kuhar, M. J. Impulse-flow regulation of high affinity choline uptake in brain cholinergic nerve terminals. Nature 255, 162–163 (1975). 12. Murrin, L. C. & Kuhar, M. J. Activation of high-affinity choline uptake in vitro by depolarizing agents. Mol. Pharmacol. 12, 1082–1090 (1976). 13. Pascual, J. et al. High-affinity choline uptake carrier in Alzheimer’s disease: implications for the cholinergic hypothesis of dementia. Brain Res. 552, 170–174 (1991). 14. Bissette, G., Seidler, F. J., Nemeroff, C. B. & Slotkin, T. A. High affinity choline transporter status in Alzheimer’s disease tissue from rapid autopsy. Ann. NY Acad. Sci. 777, 197–204 (1996). 15. Nelson, N. The family of Na+/Cl– neurotransmitter transporters. J. Neurochem. 71, 1785–1803 (1998). 16. Berrard, S. et al. cDNA cloning and complete sequence of porcine choline acetyltransferase: in vitro translation of the corresponding RNA yields an active protein. Proc. Natl. Acad. Sci. USA 84, 9280–9284 (1987). 17. Alfonso, A. et al. The Caenorhabditis elegans unc-17 gene: a putative vesicular acetylcholine transporter. Science 261, 617–619 (1993). 18. Wurtman, R. J. Choline metabolism as a basis for the selective vulnerability of cholinergic neurons. Trends Neurosci. 15, 117–122 (1992). 19. The C. elegans Sequencing Consortium. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282, 2012–2018 (1998). 20. Hediger, M. A. & Rhoads, D. B. Molecular physiology of sodium-glucose cotransporters. Physiol. Rev. 74, 993–1026 (1994).
nature neuroscience • volume 3 no 2 • february 2000
21. Nikawa, J., Hosaka, K., Tsukagoshi, Y & Yamashita, S. Primary structure of the yeast choline transport gene and regulation of its expression. J. Biol. Chem. 265, 15996–16003 (1990). 22. Schloss, P., Mayser, W. & Betz, H. The putative rat choline transporter CHOT1 transports creatine and is highly expressed in neural and musclerich tissues. Biochem. Biophys. Res. Commun. 198, 637–645 (1994). 23. Oh, J. D. et al. Cholinergic neurons in the rat central nervous system demonstrated by in situ hybridization of choline acetyltransferase mRNA. Neuroscience 47, 807–822 (1992). 24. Roghani, A. et al. Molecular cloning of a putative vesicular transporter for acetylcholine. Proc. Natl. Acad. Sci. USA 91, 10620–10624 (1994). 25. Vickroy, T. W., Roeske, W. R. & Yamamura, H. I. Sodium-dependent highaffinity binding of [3H]hemicholinium-3 in the rat brain: a potentially selective marker for presynaptic cholinergic sites. Life Sci. 35, 2335–2343 (1984). 26. Sandberg, K. & Coyle, J. T. Characterization of [3H]hemicholinium-3 binding associated with neuronal choline uptake sites in rat brain membranes. Brain Res. 348, 321–330 (1985). 27. Kuhar, M. J. & Zarbin, M. A. Synaptosomal transport: a chloride dependence for choline, GABA, glycine and several other compounds. J. Neurochem. 31, 251–256 (1978). 28. Erickson, J. D. et al. Functional identification of a vesicular acetylcholine transporter and its expression from a “cholinergic” gene locus. J. Biol. Chem. 269, 21929–21932 (1994). 29. Bejanin, S., Cervini, R., Mallet, J. & Berrard, S. A unique gene organization for two cholinergic markers, choline acetyltransferase and a putative vesicular transporter of acetylcholine. J. Biol. Chem. 269, 21944–21947 (1994). 30. Barker, L. A. & Mittag, T. W. Comparative studies of substrates and inhibitors of choline transport and choline acetyltransferase. J. Pharmacol. Exp. Ther. 192, 86–94 (1975). 31. Vogelsberg, V., Neff, N. H. & Hadjiconstantinou, M. Cyclic AMP-mediated enhancement of high-affinity choline transport and acetylcholine synthesis in brain. J. Neurochem. 68, 1062–1070 (1997). 32. Beeri, R. et al. Enhanced hemicholinium binding and attenuated dendrite branching in cognitively impaired acetylcholinesterase-transgenic mice. J. Neurochem. 69, 2441–2451 (1997). 33. Kar, S. et al. Amyloid β-peptide inhibits high-affinity choline uptake and acetylcholine release in rat hippocampal slices. J. Neurochem. 70, 2179–2187 (1998). 34. Kanai, Y. & Hediger, M. A. Primary structure and functional characterization of a high-affinity glutamate transporter. Nature 360, 467–471 (1992). 35. Cassata, G. et al. Rapid expression screening of Caenorhabditis elegans homeobox open reading frames using a two-step polymerase chain reaction promoter-gfp reporter construction technique. Gene 212, 127–135 (1998). 36. Mello, C. C., Kramer, J. M., Stinchcomb, D. & Ambros, V. Efficient gene transfer in C. elegans extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, 3959–3970 (1991). 37. Saitou, N. & Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425 (1987).
125
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Receptors with opposing functions are in postsynaptic microdomains under one presynaptic terminal
© 2000 Nature America Inc. • http://neurosci.nature.com
Guoshan Tsen1, Brian Williams1, Pauline Allaire2, Yu-Dong Zhou1, Ognian Ikonomov3, Ivanela Kondova4 and Michele H. Jacob1 1
Department of Neuroscience, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 02111, USA
2
Blackstone-Millville Regional High School, 175 Lincoln St., Blackstone, Massachusetts 01504, USA
3
Dept. of Psychiatry, Wayne State University Med. Ctr., 540 E. Canfield St., Detroit, Michigan 48201, USA
4
Department of Infectious Disease, Tufts University Veterinary School, 200 Westboro Rd., Grafton, Massachusetts 01536, USA The first two authors contributed equally to this work. Correspondence should be addressed to M.H.J. (
[email protected])
Fast excitatory synaptic transmission through vertebrate autonomic ganglia is mediated by postsynaptic nicotinic acetylcholine receptors (nAChRs). We demonstrate a unique postsynaptic receptor microheterogeneity on chick parasympathetic ciliary ganglion neurons—under one presynaptic terminal, nAChRs and glycine receptors formed separate but proximal clusters. Terminals were loaded with [3H]glycine via the glycine transporter-1 (GlyT-1), which localized to the cholinergic presynaptic terminal membrane; depolarization evoked [3H]glycine release that was calcium independent and blocked by the GlyT-1 inhibitor sarcosine. Ganglionic synaptic transmission mediated by nAChRs was attenuated by glycine. Coexistence of separate clusters of receptors with opposing functions under one terminal contradicts Dale’s principle and provides a new mechanism for modulating synaptic activity in vivo.
Nicotinic acetylcholine receptors mediate fast excitatory synaptic transmission through all ganglia in the vertebrate peripheral nervous system (PNS). It is thought that this synapse functions as a simple relay, and that modulation occurs centrally through the integration of excitatory and inhibitory inputs to the preganglionic neurons. However, functional inhibitory glycine receptors (GlyRs) were found on embryonic chick parasympathetic ciliary ganglion (CG) neurons1, raising questions as to their spatial distribution and physiological significance. These issues are particularly intriguing, as each ciliary neuron is innervated by only one presynaptic terminal, a large calyx-type ending2,3. Moreover, the terminal is cholinergic and is derived from the sole source of presynaptic input to the CG, the accessory oculomotor nucleus (AON)2–8. Multiple synaptic contacts are formed in the region of apposition between the calyx ending and the postsynaptic neuron. According to the current interpretation of Dale’s principle, all of the active zones of the presynaptic terminals derived from one axon release the same combination of neurotransmitters, and all of the underlying specialized postsynaptic membrane regions on one neuron are predicted to contain the same receptor types9,10. We show here that this is not the case. We demonstrate a unique postsynaptic receptor microheterogeneity: under a single presynaptic terminal, excitatory nAChR clusters and separate but proximal inhibitory GlyR clusters are localized in discrete membrane microdomains. These findings are surprising, considering that these receptors respond to different fast-acting transmitters and have opposing actions. 126
RESULTS On chick ciliary neurons, nAChRs are localized predominantly in the postsynaptic membrane (Fig. 1)11–13. We showed this at the ultrastructural level with immunocytochemistry using monoclonal antibody (mAb) 35 to nAChRs, visualized with horseradish peroxidase (HRP). In this study, ‘nAChR’ refers strictly to the α3-containing nAChRs, which are concentrated in the postsynaptic membrane and are specifically recognized by mAb 35, and does not include the α7-containing nAChRs, which are perisynaptic, excluded from the postsynaptic membrane and not recognized by mAb 35 (refs. 13-16). We defined synapses by characteristic morphological features—a thickened and parallel arrangement of the pre-and postsynaptic membranes, an accumulation of synaptic vesicles adjacent to the presynaptic density, an enhanced postsynaptic density and a widened synaptic cleft. Concentrations of nAChRs are found in patches of postsynaptic membrane demarcated by the postsynaptic density along their cytoplasmic face and lying opposite the presynaptic density of the active zone. However, labeling for nAChRs was not found in all of the specialized postsynaptic membrane microregions under one calyx ending (Fig. 1a). This selective staining pattern was unlikely to result from limited penetration of labeling reagents, as unlabeled postsynaptic membrane microregions were close to labeled ones. GlyRs were concentrated in similar specialized postsynaptic membrane microdomains on late-stage embryonic ciliary neurons as shown by immunolabeling with either mAb 4a or mAb 2b and ultrastructural analysis (Fig. 1b). On each neuron examined, some, but not all, membrane microregions demarcated by nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 1. Ultrastructural localization of nAChRs, GlyRs and gephyrin at discrete postsynaptic membrane microdomains under the calyx-type presynaptic terminal on E15–17 chick ciliary neurons in vivo. The three components were present at only a subset of the postsynaptic membrane microdomains demarcated by the postsynaptic density along their cytoplasmic faces and lying opposite the synaptic vesicle accumulations at the active zone (labeled synapse, black arrowhead; unlabeled synapse, white arrowhead). (a) nAChRs detected by immunolabeling with mAb 35. (b) GlyRs labeled with mAb 2b. (c) gephyrin labeled with mAb 7a (visualized with HRP). Scale bar, 1 µm. (d) Schematic representation of the relative distribution of nAChRs, GlyRs and gephyrin at specialized postsynaptic membrane microdomains under the calyx terminal (nt; synaptic vesicles, sv; short dendrites, d; based on data in Figs. 1 and 2).
a
b
d
the postsynaptic density were labeled for GlyRs. The presence of both GlyR and nAChR accumulations in postsynaptic membrane microdomains under the cholinergic calyx terminal was unexpected. As gephyrin is a peripheral membrane protein known to codistribute with GlyRs at synapses and is required for GlyR clustering on rodent CNS neurons18–20, we used it as a positive control to examine the relative distribution of GlyRs and nAChRs on avian ciliary neurons. We first determined that gephyrin was expressed in avian CG neurons and that the avian and rodent sequences were highly conserved, suggesting that mAbs to rodent gephyrin could be used for localization studies in chick. Specifically, we isolated the full-length gephyrin coding sequence from a chick brain cDNA library (GenBank accession number AF174130). The avian and rodent sequences showed 87% identity at the nucleotide level and 98% identity at the amino-acid level. We then examined gephyrin mRNA expression in the chick CG by using RT-PCR amplification of total ganglionic RNA. Because five alternatively spliced variants of gephyrin are expressed in the rodent in a tissue-specific pattern21, we used seven different pairs of gephyrin-specific primers to flank all of the known alternatively spliced cassettes identified in rodent cDNA (see Methods). We exclusively detected the gephyrin mRNA isoform containing the C2 cassette in the chick CG, as determined by size and sequence analysis of the PCR amplification products (n = 14 separate experiments; data not shown). This is also the dominant isoform expressed in the rodent CNS21. Immunocytochemical labeling of avian ciliary neurons with anti-gephyrin mAb 5a or mAb 7a20,22 and ultrastructural analysis demonstrated gephyrin distribution similar to that of the receptors, with labeling present at only a subset of the specialized postsynaptic membrane microdomains under the calyx (Fig. 1c). A minor difference was that gephyrin staining was concentrated at the postsynaptic density rather than at the postsynaptic membrane. To determine the synaptic distribution of nAChRs, GlyRs and gephyrin relative to one another, we used immunofluorescent double labeling with laser-scanning confocal microscopy. In both late-stage embryonic and adult CGs, GlyR (red) and gephyrin (green) clusters were colocalized on the neuron surface, as indicated by the predominance of yellow fluorescent patches (Fig. 2a). In contrast, nAChR (red) and gephyrin (green) clusters did not overlap, as indicated by distinct patches of red or green fluorescence (Fig. 2b). Separate nAChR and GlyR/gephyrin nature neuroscience • volume 3 no 2 • february 2000
c
clusters were present in approximately equal proportions on all CG neurons at stages after pre-and postganglionic synapse formation, ranging from late-stage embryonic ages to reproductively mature adults. Functional GlyRs were present on CG neurons at earlier embryonic ages as well, but their expression was developmentally delayed relative to functional nAChRs1. As independent confirmation of the GlyR and gephyrin colocalization results, we showed by the yeast two-hybrid genetic assay that chick gephyrin specifically interacts with the chick GlyR β-subunit, but not with nAChR subunits (Fig. 2c). We tested for gephyrin interactions with the major cytoplasmic loop of the receptor subunits, as the gephyrin binding motif in the rodent GlyR is a linear 18-amino-acid (aa) sequence in the β-subunit long cytoplasmic loop23,24. We established that this 18-aa sequence was completely conserved in the chick GlyR β-subunit (GenBank accession number AF181717) as determined by RT-PCR amplification of CG total RNA using specific primers corresponding to the mammalian GlyR β-subunit sequence. The gephyrin binding motif was absent from neuronal nAChR subunits. Only yeast transformants co-expressing the chick GlyR β-subunit loop and gephyrin showed transcriptional activation of the two reporter genes, HIS3 and LacZ (Fig. 2c). Altogether, the colocalization studies revealed a synaptic microheterogeneity consisting of separate but proximal clusters of nAChRs and of GlyRs in discrete postsynaptic membrane microdomains under one presynaptic terminal (Fig. 1d). The protein-interaction data suggest that different molecules organize the nAChR and GlyR clusters in the distinct postsynaptic microdomains. To determine whether this synaptic heterogeneity was a unique feature of a calyx-type synapse, we examined the choroid neuron subpopulation in the chick CG, as they are innervated by multiple typical bouton-type endings. Each choroid neuron receives inputs from two to three preganglionic neurons in the AON3. Separate clusters of nAChRs and of GlyRs (and the GlyRassociated protein gephyrin) were detected in distinct postsynaptic membrane regions under separate bouton terminals (Fig. 2d). Although there may be separate glycinergic and cholinergic inputs to the choroid neurons, this seems unlikely, as all 127
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
presynaptic terminals to the CG are derived from the AON and are cholinergic2–8. Thus, as for the calyceal synapse, heterogeneous microdomains occur under axonal branches terminating in multiple bouton-type endings. We examined the functional effects of GlyR activation in CG neurons. Using acutely isolated, intact E15–17 ganglia, we stimulated the preganglionic nerve and extracellularly recorded postsynaptic responses with or without exogenous glycine (0.5–1 mM, Fig. 3). Glycine reduced initial slope of the nAChRmediated excitatory postsynaptic potential (EPSP; Fig. 3b and c) by 30% and peak-to-peak amplitude of the postganglionic compound action potential (a.p.) by 65% (data not shown), but did not change the preganglionic a.p. volley as indicated by the electrical coupling potential (Fig. 3b). This inhibition was completely reversed following washout of glycine. Strychnine (1–10 µM), a GlyR antagonist, was not used to test for GlyR involvement because it also blocks nAChRs on CG neurons (data not shown)25. Compared with glycine, hexamethonium (0.5 mM), anAChR antagonist, decreased initial slope of the EPSP by 70% (Fig. 3a and c) and the compound a.p. amplitude by 80%, consistent with earlier reports of partial block by hexamethonium but complete inhibition of nAChR-mediated excitatory responses in the CG by other nicotinic cholinergic antagonists26. Tetrodotoxin (1 µM) abolished all postsynaptic responses (Fig. 3a and c). Our results were similar to those of previous electrophysiological studies of CG neurons showing that activation of the chloride-selective GlyR channel drives the cell toward the chloride equilibrium potential (near the resting potential and away from a.p. threshold) and that activation of the GABAA receptor, another chloride-selective channel, completely blocks synaptic transmission through the CG at the embryonic age tested here1,27,28. In sum, GlyR activation inhibits excitatory synaptic activity in the late-stage embryonic chick CG.
a
b
To study the functional significance of inhibitory GlyR accumulations at these largely cholinergic synapses, we investigated potential sources of endogenous glycine in the CG and conditions that lead to its release. Glycine is present in blood at a high concentration (0.5 mM)29. Glycine transporters (GlyTs) provide an avenue for glycine uptake, but operate in reverse to release glycine under certain physiological conditions (such as strong depolarization and high internal sodium concentration)30. We established that the two GlyTs, GlyT-1 and GlyT-2, were present in the chick CG at both late embryonic and adult stages based on immunolabeling and uptake studies. The two transporters had different distributions as determined by anti-GlyT-1 and anti-GlyT-2 specific antisera and immunofluorescence microscopy (Fig. 4a and b). GlyT-1 (green) was localized predominantly in patches on the presynaptic terminal surface membrane and colocalized with synaptic-vesicle immunolabeling (red) in the late-stage embryonic and adult ganglia (Fig. 4a). GlyT-1 labeling was also present on neuronal cell bodies, but not on Schwann cells. In contrast, GlyT-2 labeling (red) was detected only on Schwann cells (Fig. 4b). It should be noted that the localization of GlyT-1 on presynaptic nerve terminals and GlyT-2 on Schwann cells in this avian peripheral ganglion is reversed from their typical distribution in the mammalian CNS. However, reported exceptions include the retina, where GlyT-1 is expressed on nerve terminals but not on glia, and the cerebellum, where GlyT-2 is on both glia and terminal boutons31. In addition, we determined that, in the chick CG, GlyT1 and GlyT-2 facilitated uptake of exogenous glycine. Acutely isolated, intact E15–17 ganglia were treated with collagenase to increase reagent access, incubated with [3H]glycine (1 µM), rinsed and processed either for scintillation counting or light-microscopic autoradiographic analysis. In addition, the intact ganglia were incubated with FM1-43 to label synaptic vesicles and thereby identify presynaptic terminals. Adjacent sections were processed for fluorescence or autoradiography. We observed dense clusters
c
d Yeast two-hybrid assay
Gephyrin interaction with
Fig. 2. Segregation of nAChR clusters from clusters of GlyRs and their directly associated protein gephyrin in postsynaptic membrane microdomains, including those under separate cholinergic bouton-type terminals on CG choroid neurons. (a) Confocal micrograph of a single E21 CG neuron showing colocalization of GlyR (red) and gephyrin (green) clusters on the neuron surface (predominance of yellow fluorescent patches) by immunofluorescent double labeling. In addition, there were a few gephyrin clusters (green patches) lacking in GlyR staining. Either these sites may represent a distinct subset of gephyrin clusters or the plane of section in these regions may favor the intracellular postsynaptic density (gephyrin localization) and show less of the postsynaptic surface membrane (GlyR localization). Only 2 optical sections (each 0.5 µm) were summed in this image; including additional optical sections resulted in complete overlap, yielding only yellow patches. (b) In contrast, nAChR (red) and gephyrin (green) clusters did not overlap on the E21 CG neuron surface (distinct red or green patches). Scale bar, 10 µm. (c) Yeast two-hybrid genetic assay showing chick gephyrin specifically interacts with chick GlyR β-subunit long cytoplasmic loop, but not with nAChR subunit loops. For the β-gal assay, +++, blue color within 1 h; –, not blue after overnight. For the HIS3 assay, +, overnight growth; – no growth on histidine-deficient media. (d) Electron micrograph showing nAChRs at the specialized postsynaptic membrane microdomains under a subset of bouton-type endings (nt) on a choroid neuron in the E15–17 CG in vivo (black arrowhead, labeled synapse; white arrowhead, unlabeled synapse). Scale bar, 1.2 µm. 128
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
b
0.2 mV 3 ms
© 2000 Nature America Inc. • http://neurosci.nature.com
0.1 mV
Fig. 3. Inhibitory GlyR response in CG neurons. (a) Schematic showing the position of the recording electrode used to measure postsynaptic responses extracellularly following direct electrical stimulation of the preganglionic nerve in an acutely isolated, intact E15–17 CG. Top trace (control) shows a typical postsynaptic response composed of the coupling potential (); due to direct electrical connection between pre- and postsynaptic cells, followed with a slight delay by the chemically mediated field EPSP ()4,5. Bath-applied hexamethonium (0.5 mM) decreased the initial slope of the field EPSP, with no detectable alteration in the coupling potential. Tetrodotoxin (1 µM) abolished all postsynaptic responses. (b) Representative trace showing that exogenous glycine (0.5 mM) reduced the initial slope of the nAChR-mediated EPSP (), with no change in the electrical coupling potential (). (c) Histogram of EPSP initial slope values expressed as the ratio of test over control (mean ± s.e.; number of postsynaptic responses measured is shown in parentheses above the bars; **p < 0.005, ***p < 0.001, Student’s t-test.
of silver grains representing [3H]glycine uptake over presynaptic terminals and Schwann cells, with fewer grains over the neuronal cell bodies (Fig. 4c). Pre- and co-incubation of CGs with sarcosine, a selective GlyT-1 inhibitor 32,33, dramatically reduced [3H]glycine uptake in a concentration-dependent manner; at 0.5, 1 and 5 mM, sarcosine decreased [3H]glycine levels per CG by 50%, 60% and 70%, respectively. Moreover, in the presence of 5 mM sarcosine, fewer silver grains were observed over presynaptic terminals and neuronal somata, whereas label intensity over Schwann cells was not detectably altered (Fig. 4d). In comparison, the addition of 1,000-fold excess cold glycine reduced [3H]glycine levels per CG by 80% and drastically lowered the number of silver grains over terminals, neuronal somata and Schwann cells (Fig. 4e). Depolarization of these radiolabeled ganglia with 30 mM KCl induced the release of [3H]glycine (Fig. 4f). The release was Ca2+ independent and blocked by the GlyT-1 antagonist sarcosine or an excess of cold glycine (Fig. 4g), consistent with a non-vesicular, transport-mediated mechanism. Altogether, these results suggest that GlyT-1 on the presynaptic terminals probably mediates depolarization-induced glycinergic synaptic transmission in the chick CG.
DISCUSSION We demonstrated separate clusters of excitatory nAChRs and inhibitory GlyRs in distinct postsynaptic membrane microdomains under one presynaptic terminal in vivo. As these receptors respond to different fast-acting transmitters and generally have opposing functions, the presence of both GlyRs and nAChRs under one presynaptic ending is surprising. Glycine nature neuroscience • volume 3 no 2 • february 2000
1 ms
c
attenuated synaptic transmission mediated by nAChRs in the CG. We propose that two distinct release mechanisms, vesicular acetylcholine release and non-vesicular, transport-mediated glycine efflux, both occur at the calyceal synapse on ciliary neurons in vivo and jointly regulate ganglionic transmission. Our data suggest that GlyT-1 on the cholinergic presynaptic terminal mediates depolarization-induced glycinergic synaptic transmission in the CG. Amino-acid transporters on presynaptic terminals release high levels of transmitter in response to depolarization and can function as a relatively fast release mechanism34. The depolarization protocol required to activate GlyT-1-mediated efflux in the CG in vivo is not yet defined. It should be noted that nAChRs composed of α7 subunits are present on the presynaptic calyx ending and may contribute to depolarization of the terminal35. CG GlyRrich synaptic microregions do not lack presynaptic vesicles, as previously reported for synapses with strictly transporter-mediated release. These microregions lack classical structural features of inhibitory synapses such as pleomorphic or flattened vesicles; instead, they have small, clear, round presynaptic vesicles, resembling the neighboring cholinergic synaptic microregions30,36. Strikingly similar to the co-existence of vesicular acetylcholine release and transport-mediated glycine efflux suggested by our observations at synapses in the CG is the demonstration that retinal starburst amacrine cells corelease ACh and GABA via vesicular and carriermediated mechanisms, respectively37. The two release mechanisms differ in their extracellular Ca2+ requirements and in the ranges of membrane voltages over which they are active30,34,37, suggesting that dynamic shifts in the release of transmitters with opposing functions from single terminals in the CG are possible. 129
© 2000 Nature America Inc. • http://neurosci.nature.com
The receptor arrangement reported here represents an unexpected degree of complexity and heterogeneity of functionally specialized subdomains in the neuronal postsynaptic membrane. Postsynaptic receptor microheterogeneity may have relevance to the mammalian CNS as well, as suggested by the demonstration that two fast-acting excitatory and inhibitory neurotransmitters are coreleased by a single presynaptic CNS neuron, possibly at the same synapse, in vitro38. The presence under one terminal of two distinct receptor types responding to different fast transmitters with opposing functions may represent an important mechanism for modulating activity at a monosynaptic connection in vivo.
METHODS Electron microscopy. The localization of nAChRs and GlyRs in postsynaptic membrane microdomains on the CG neuron surface was established at the ultrastructural level. Briefly, CGs were dissected from White Leghorn chick embryos in ovo (Spafas) at E15–17, incubated in 0.1 µM primary mAb followed by 0.1 µM biotinylated secondary antibody and strepavidin–biotin–HRP complex (Vector Labs, Burlingame, California), fixed, reacted for peroxidase activity, and processed for electron microscopy11–13. The nAChRs were detected by using rat mAb 35, and GlyRs were detected using mouse mAb 4a or 2b (provided by Heinrich Betz, Max-Planck Institute for Brain Research, Frankfurt, Germany)17. As a control, CGs were incubated in the absence of primary mAb. Thin sections were stained with 5% aqueous uranyl acetate and examined with a Philips CM10 electron microscope (FEI Company, Hillsboro, Oregon). Anti-nAChR mAb 35 from a hybridoma isolated by Jon Lindstrom and colleagues (University of Pennsylvania, Philadelphia, Pennsylvania) was purified as described39. 130
Release per ganglion (ratio test: control)
Fig. 4. Glycine transporter localization d c a b and glycine uptake and release in the CG. (a) Immunofluorescence micrograph of a single double-labeled E16 CG neuron showing GlyT-1 (green) predominantly on presynaptic terminals, where it partially overlapped with synaptic vesicles (SV2 antigen, red; overlap, yellow). GlyT-1 was on the neuronal soma, but not on e Schwann cells. (b) In contrast, GlyT-2 (red) was localized only on Schwann cells and did not overlap with synaptic-vesicle staining (green). Scale bar, 10 µm. f g (c–e) Autoradiograms showing exogenous [3H]glycine uptake sites in the acutely isolated E15–17 CG. (c) Dense clusters of silver grains were found over presynaptic terminals and Schwann cells, with fewer grains over neuronal soma. (d) Pre- and co-incubation with sarcosine, a selective GlyT-1 inhibitor, sharply reduced the number of silver grains over terminals and neuronal somata, whereas the grain density over Schwann cells was unaltered. (e) Addition of 1,000-fold excess cold glycine drastically lowered silver grain levels over all CG areas. Sections were Nissl stained to mark neurons and Schwann cells. Scale bar, 30 µm. (f) Depolarization (using 30 mM KCl) induced [3H]glycine release from a preloaded ganglion. (g) Amount of release was unaltered by adding Cd2+ (0.1 mM) or reducing Ca2+ levels (from 5.4 mM to 0.2 mM), whereas sarcosine (5 mM) and excess cold glycine (1 mM) decreased high-K+-induced [3H]glycine release. Data are expressed as the mean ± s.e. of the ratio of the proportion of total ganglionic [3H]glycine released into the medium in test over control conditions. For each condition, n = 6. *p < 0.02, Student’s two-tailed t-test. Release per ganglion (ratio test: control)
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
The ultrastructural distribution of gephyrin in the chick CG was established using the anti-rat gephyrin mAbs 5a and 7a (gift from Heinrich Betz, Max-Planck Institute)20,22. To gain intracellular access for gephyrin immunolabeling, freshly dissected E15–17 CGs were lightly fixed, detergent-permeabilized with saponin12, incubated with mAb 5a or 7a and processed as described above. Laser-scanning confocal microscopy. Double-labeling immunofluorescence and laser-scanning confocal microscopy (Leica TCS) were done as described40,41. Both late-stage embryonic (E15-E21) and adult CGs were analyzed. (Freshly decapitated heads of reproductively mature adult White Leghorn chickens were obtained from a local fresh poultry supplier.) The nAChRs were detected by mAb35 and Cy-3-conjugated antirat IgG, gephyrin by mAb 7a and FITC-conjugated anti-mouse IgG, and GlyRs by mAb 2b and Cy3-conjugated anti-mouse IgG (primary mAbs used at 1:100–1:200 dilution; secondary IgGs used at 1:1000; Vector Labs; Jackson ImmunoResearch Labs, West Grove, Pennsylvania). The antirat and anti-mouse IgGs were affinity purified to eliminate cross-reactivity with mouse and rat primary mAbs, respectively. Double-labeling with the GlyR and gephyrin mouse mAbs was carried out using a previously described protocol for multiple staining with antibodies raised in the same species42. As controls to test for specific binding, we omitted the first or second primary mAb and reversed the antibody sequence in separate tests. Light microscopy. To establish the cellular localization of GlyTs in E15–E17 and adult CGs, frozen ganglionic sections (6–8 µm thickness)12 were labeled with goat anti-GlyT-1 or guinea pig anti-GlyT-2 specific antisera (1:200 and 1:500 dilution, respectively; Chemicon International, Temecula, California) and FITC-conjugated anti-goat IgG (1:500; Vector Labs) and Cy3-conjugated anti-guinea pig IgG (1:1000; Jackson ImmunoResearch Labs). To determine the distribution of GlyTs relative nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
to synapses, synaptic vesicles were stained using anti-SV2 mAb (1:200 dilution; gift from Kathy Buckley, Harvard Medical School)43 and FITCor TRITC-conjugated anti-mouse IgG (1:1000 dilution; Vector Labs).
© 2000 Nature America Inc. • http://neurosci.nature.com
Isolation and sequencing of chick gephyrin cDNA. The full-length chick gephyrin clone was isolated by screening a White Leghorn E13 chick brain λgt10 cDNA library (2 × 106 pfu) with a [32P]dCTP-labeled rat gephyrin cDNA probe (908 bp) using standard procedures44 (chick brain cDNA library was provided by Barbara Ranscht, The Burnham Institute, La Jolla, California and the rat gephyrin clone by Heinrich Betz, MaxPlanck Institute. We isolated a single positive plaque with an insert size of 3.1 kb. The identity of the insert as gephyrin was established by Southern blot hybridization to rat gephyrin cDNA as probe and by sequence analysis (Sequenase Version 2.0 DNA sequencing kit, United States Biochemical Corporation, Cleveland, Ohio) after subcloning the full-length chick cDNA and smaller restriction enyzme digestion fragments into Bluescript II SK vector (Stratagene, La Jolla, California). RT-PCR analysis of gephyrin alternative-splice variants. Total RNA was extracted from CGs (at selected ages ranging from E9 to E15) using Tri Reagent (Molecular Research Center, Cincinnati, Ohio) according to the manufacturer’s instructions. Using an amount of total RNA equivalent to that present in a single CG, RT-PCR was done as described45. Seven different pairs of gephyrin specific primers were used to characterize the alternatively spliced variants expressed in the CG: to flank the C1 and C2 cassettes, we used sense (nt 315–334) and antisense (nt 552–571)21 primers; to flank C3, sense (nt 615–634 or nt 780–797) and antisense (nt 1011–1028) primers; to flank C4, sense (nt 1011–1028) and antisense (nt 1204–1223 or nt 1215–1232) primers; to flank C3 and C4, sense (nt 615–634 or 780–797) and antisense (nt 1204–1223) primers. Amplification products were separated by 2% agarose-gel electrophoresis and stained with ethidium bromide. Identities of the products were confirmed by Southern blot hybridization with a chick gephyrin cDNA probe and sequence analysis. Yeast two-hybrid assay. Yeast two-hybrid genetic assay was done as described46,47. Bait constructs were expressed as recombinant peptide fragments fused to the DNA-binding protein lexA, using pBTM116 vector (gift from Peter Pryciak, University of Massachusetts Medical Center). Target constructs were expressed as a fusion peptide with the Gal4 activation domain protein, using the pAD-GAL4 vector (Stratagene). To test for interactions, chick full-length gephyrin and the major cytoplasmic loop of either chick GlyR β or nAChR α3, α5, β4, β2 or α7 were coexpressed in the yeast L40 reporter strain as bait and target constructs, respectively, and in the reverse orientations in separate experiments. As a negative control, single transformants were tested for transcriptional activation of reporter genes, HIS3 and LacZ. Electrophysiology. Extracellular recordings were obtained from the intact CG preparation using described techniques with minor modifications27. Briefly, the E15–17 CG was dissected with the pre-and postganglionic nerve stumps attached, mounted on a perfusion recording chamber and continuously perfused at about 2 ml per min with oxygenated recording buffer. A bipolar tungsten stimulation electrode was used to stimulate the preganglionic nerve stump with current pulses (10–20 V, 150 µs) at a frequency of 0.1 Hz. A 3–5 MΩ glass microelectrode filled with normal Krebs solution was used to extracellularly record the field EPSP and compound a.p. triggered by synaptic transmission. The effect of drugs on the initial slope of the field EPSP and peak-to-peak amplitude of the compound a.p. were measured. Drugs were added directly into the perfusate. Each trace was averaged 5–10 times. Glycine, strychnine, hexamethonium and tetrodotoxin were obtained from Sigma. Rough calculations predict that, in the presence of 1 mM exogenous glycine, CG neuron [Na+]i may increase at most by 1.5 mM due to cotransport via GlyT-1. This change in [Na+]i is not expected to affect the driving force for the nAChR current. Glycine uptake and autoradiographic analysis. For [3H]glycine uptake studies, E15–17 CGs were dissected into oxygenated recording buffer, incubated with collagenase type A (1 mg per ml, Boehringer nature neuroscience • volume 3 no 2 • february 2000
Mannheim Biochemicals, Indianapolis, Indiana) in divalent-free buffer 28 at 37°C for 10 min, rinsed and incubated with 1 × 10 –6 M [3H]glycine (41.1 Ci per mmol; New England Nuclear, Boston, Massachusetts) in oxygenated recording buffer at 37°C for 1 h followed by rinsing in buffer four times. To determine the total number of counts per CG, single ganglia were dried on Whatman filter paper (2.4 cm) and counted using a scintillation counter (LS 5000TD, Beckman Coulter, Fullerton, California). To localize [3H]glycine uptake sites, other radiolabeled CGs were fixed in 3% glutaraldehyde in PBS (pH 7.4) at RT for 1 h or at 4°C overnight, and processed for embedding in either paraffin or Embed 812 (Electron Microscopy Sciences, Fort Washington, Pennsylvania) and for light microscopic autoradiographic analysis 48,49. To label synaptic vesicles in presynaptic terminals, freshly dissected CGs were incubated in oxygenated recording buffer with 90 mM KCl and 10 µm FM1-43 (Molecular Probes, Eugene, Oregon) at 37°C for 1 min 50 , rinsed, then incubated with [ 3 H]glycine and processed as described above except that alternate sections of the paraffin-embedded ganglia were processed for fluorescence analysis with a Zeiss Axioskop light microscope. Glycine release assays. For release assays, E15–17 CGs were labeled with [3H]glycine as detailed above and incubated singly at 37°C for 15 min in a 24-well plate in 200 µl of recording buffer alone (as a negative control), 30 mM KCl in recording buffer (to depolarize) or high-K+ buffer containing either Cd2+ (0.1 mM), low Ca2+ levels (0.2 mM in contrast to 5.4 mM), sarcosine (5 mM) or excess cold glycine (1 mM). CGs were pre-incubated in the test condition without high K+ for 10 min. The buffer and the CG were counted separately in a scintillation counter (LS 5000TD, Beckman).
ACKNOWLEDGEMENTS We acknowledge Heinrich Betz for providing glycine receptor and gephyrin antibodies and clones, Yimen Ge (Massachusetts General Hospital, Harvard Medical School) for assistance with the laser-scanning confocal microscope and Kathleen Dunlap, Daniel Jay and Tim Turner for advice and comments on the manuscript. This work was supported by NIH grant 21725 to M.H.J.
RECEIVED 9 SEPTEMBER; ACCEPTED 9 DECEMBER 1999 1. Zhang, Z. W. & Berg, D. K. Patch-clamp analysis of glycine-induced currents in chick ciliary ganglion neurons. J. Physiol. (Lond.) 487, 395–405 (1995). 2. Landmesser, L. & Pilar, G. The onset and development of transmission in the chick ciliary ganglion. J. Physiol. (Lond.) 222, 691–713 (1972). 3. Landmesser, L. & Pilar, G. Synaptic transmission and cell death during normal ganglionic development. J. Physiol. (Lond.) 241, 737–749 (1974). 4. Martin, A. R. & Pilar, G. Dual mode of synaptic transmission in the avian ciliary ganglion. J. Physiol. (Lond.) 168, 443–463 (1963). 5. Martin, A. R. & Pilar, G. Transmission through the ciliary ganglion of the chick. J. Physiol. (Lond.) 168, 464–475 (1963). 6. Reiner, A. et al. Neurotransmitter organization of the nucleus of EdingerWestphal and its projection to the avian ciliary ganglion. Vis. Neurosci. 6, 451–472 (1991). 7. Engisch, K. L. & Fischbach, G. D. The development of ACh- and GABAactivated currents in embryonic chick ciliary ganglion neurons in the absence of innervation in vivo. J. Neurosci. 12, 1115–1125 (1992). 8. Arenella, L. S., Oliva, J. M. & Jacob, M. H. Reduced levels of acetylcholine receptor expression in chick ciliary ganglion neurons developing in the absence of innervation. J. Neurosci. 13, 4525–4537 (1993). 9. Dale, H. Pharmacology and nerve-endings. Proc. R. Soc. Med. (Lond.) 28, 319–332 (1935). 10. Nicoll, R. A. & Malenka, R. C. A tale of two transmitters. Science 281, 360–361 (1998). 11. Jacob, M. H., Lindstrom, J. M. & Berg, D. K. Surface and intracellular distribution of a putative neuronal nicotinic acetylcholine receptor. J. Cell Biol. 103, 205–214 (1986). 12. Jacob, M. H. Acetylcholine receptor expression in developing chick ciliary ganglion neurons. J. Neurosci. 11, 1701–1712 (1991). 13. Williams, B. M. et al. The long internal loop of the alpha 3 subunit targets nAChRs to subdomains within individual synapses on neurons in vivo. Nat. Neurosci. 1, 557–562 (1998). 14. Jacob, M. H., & Berg, D. K. The ultrastructural localization of αbungarotoxin binding sites in relation to synapses on chick ciliary ganglion neurons. J. Neurosci. 3, 260–271 (1983).
131
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
15. Jacob, M. H., Berg, D. K. & Lindstrom, J. M. Shared antigenic determinant between the Electrophorus acetylcholine receptor and a synaptic component on chick ciliary ganglion neurons. Proc. Natl. Acad. Sci. USA 81, 3223–3227 (1984). 16. Vernallis, A. B., Conroy, W. G. & Berg, D. K. Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor sites. Neuron 10, 451–464 (1993). 17. Schroder, S., Hoch, W., Becker, C. M., Grenningloh, G. & Betz, H. Mapping of antigenic epitopes on the alpha 1 subunit of the inhibitory glycine receptor. Biochemistry 30, 42–47 (1991). 18. Kirsch, J., Wolters, I., Triller, A. & Betz, H. Gephyrin antisense oligonucleotides prevent glycine receptor clustering in spinal neurons. Nature 366, 745–748 (1993). 19. Colin, I., Rostaing, P., Augustin, A. & Triller, A. Localization of components of glycinergic synapses during rat spinal cord development. J. Comp. Neurol. 398, 359–372 (1998). 20. Feng, G. et al. Dual requirement for gephyrin in glycine receptor clustering and molybdoenzyme activity. Science 282, 1321–1324 (1998). 21. Prior, P. et al. Primary structure and alternative splice variants of gephyrin, a putative glycine receptor-tubulin linker protein. Neuron 8, 1161–1170 (1992). 22. Pfeiffer, F., Simler, R., Grenningloh, G. & Betz, H. Monoclonal antibodies and peptide mapping reveal structural similarities between the subunits of the glycine receptor of rat spinal cord. Proc. Natl. Acad. Sci. USA 81, 7224–7227 (1984). 23. Meyer, G., Kirsch, J., Betz, H. & Langosch, D. Identification of a gephyrin binding motif on the glycine receptor beta subunit. Neuron 15, 563–572 (1995). 24. Kins, S., Kuhse, J., Laube, B., Betz, H. & Kirsch, J. Incorporation of a gephyrin-binding motif targets NMDA receptors to gephyrin-rich domains in HEK 293 cells. Eur. J. Neurosci. 11, 740–744 (1999). 25. Zhang, Z. W., Vijayaraghavan, S. & Berg, D. K. Neuronal acetylcholine receptors that bind alpha-bungarotoxin with high affinity function as ligandgated ion channels. Neuron 12, 167–177 (1994). 26. Marwitt, R., Pilar, G. & Weakly, J. N. Characterization of two ganglion cell populations in avian ciliary ganglia. Brain Res. 25, 317–334 (1971). 27. McEachern, A. E., Margiotta, J. F. & Berg, D. K. Gamma-Aminobutyric acid receptors on chick ciliary ganglion neurons in vivo and in cell culture. J. Neurosci. 5, 2690–2695 (1985). 28. Sorimachi, M., Rhee, J. S., Shimura, M. & Akaike, N. Mechanisms of GABAand glycine-induced increases of cytosolic Ca2+ concentrations in chick embryo ciliary ganglion cells. J. Neurochem. 69, 797–805 (1997). 29. McGale, E. H., Pye, I. F., Stonier, C., Hutchinson, E. C. & Aber, G. M. Studies of the inter-relationship between cerebrospinal fluid and plasma amino acid concentrations in normal individuals. J. Neurochem. 29, 291–297 (1977). 30. Attwell, D., Barbour, B. & Szatkowski, M. Nonvesicular release of neurotransmitter. Neuron 11, 401–407 (1993). 31. Zafra, A. F. et al. Glycine transporters are differentially expressed among CNS cells. J. Neurosci. 15, 3952–3969 (1995). 32. Liu, W., Leibach, F. H. & Ganapathy, V. Characterization of the glycine transport system GLYT 1 in human placental choriocarcinoma cells (JAR). Biochim. Biophys. Acta 1194, 176–184 (1994).
132
33. Pow, D. V. Transport is the primary determinant of glycine content in retinal neurons. J. Neurochem. 70, 2628–2636 (1998). 34. Schwartz, E. A. Depolarization without calcium can release gammaaminobutyric acid from a retinal neuron. Science 238, 350–355 (1987). 35. Coggan, J. S., Paysan, J., Conroy, W. G. & Berg, D. K. Direct recording of nicotinic responses in presynaptic nerve terminals. J. Neurosci. 17, 5798–5806 (1997). 36. Dumoulin, A. et al. Presence of the vesicular inhibitory amino acid transporter in GABAergic and glycinergic synaptic terminal boutons. J. Cell Sci. 112, 811–823 (1999). 37. O’Malley, D. M., Sandell, J. H. & Masland, R. H. Co-release of acetylcholine and GABA by the starburst amacrine cells. J. Neurosci. 12, 1394–1408 (1992). 38. Jo, Y. H. & Schlichter, R. Synaptic corelease of ATP and GABA in cultured spinal neurons. Nat. Neurosci. 2, 241–245 (1999). 39. Smith, M. A., Stollberg, J., Lindstrom, J. M. & Berg, D. K. Characterization of a component in chick ciliary ganglia that cross-reacts with monoclonal antibodies to muscle and electric organ acetylcholine receptor. J. Neurosci. 5, 2726–2731 (1985). 40. Horch, H. L. & Sargent, P. B. Perisynaptic surface distribution of multiple classes of nicotinic acetylcholine receptors on neurons in the chicken ciliary ganglion. J. Neurosci. 15, 7778–7795 (1995). 41. Horch, H. L. & Sargent, P. B. Effects of denervation on acetylcholine receptor clusters on frog cardiac ganglion neurons as revealed by quantitative laser scanning confocal microscopy. J. Neurosci. 16, 1720–1729 (1996). 42. Wang, B. L. & Larsson, L. I. Simultaneous demonstration of multiple antigens by indirect immunofluorescence or immunogold staining. Novel light and electron microscopical double and triple staining method employing primary antibodies from the same species. Histochemistry 83, 47–56 (1985). 43. Buckley, K. & Kelly, R. B. Identification of a transmembrane glycoprotein specific for secretory vesicles of neural and endocrine cells. J. Cell Biol. 100, 1284–1294 (1985). 44. Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning: a Laboratory Manual (Cold Spring Harbor Press, New York, 1989). 45. Ikonomov, O. C., Kulesa, M. C., Shisheva, A. C. & Jacob, M. H. Innervation and target tissue interactions induce Rab-GDP dissociation inhibitor (GDI) expression during peripheral synapse formation in developing chick ciliary ganglion neurons in situ. J. Neurosci. 18, 6331–6339 (1998). 46. Bartel, P., Chien, C. T., Sternglanz, R. & Fields, S. Elimination of false positives that arise in using the two-hybrid system. Biotechniques 14, 920–924 (1993). 47. Hollenberg, S. M., Sternglanz, R., Cheng, P. F. & Weintraub, H. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a twohybrid system. Mol. Cell Biol. 15, 3813–3822 (1995). 48. Jacob, M. H. & Berg, D. K. The distribution of acetylcholine receptors in chick ciliary ganglion neurons following disruption of ganglionic connections. J. Neurosci. 8, 3838–3849 (1988). 49. Boyd, R. T., Jacob, M. H., McEachern, A. E., Caron, S. & Berg, D. K. Nicotinic acetylcholine receptor mRNA in dorsal root ganglion neurons. J. Neurobiol. 22, 1–14 (1991). 50. Ryan, T. A. et al. The kinetics of synaptic vesicle recycling measured at single presynaptic boutons. Neuron 11, 713–724 (1993).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Enhancement of synaptic transmission by cyclic AMP modulation of presynaptic Ih channels Vahri Beaumont and Robert S. Zucker Division of Neurobiology, Department of Molecular and Cell Biology, University of California, Berkeley, California 94720, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to V.B. (
[email protected])
Presynaptic activation of adenylyl cyclase and subsequent generation of cAMP represent an important mechanism in the modulation of synaptic transmission. In many cases, short- to mediumterm modulation of synaptic strength by cAMP is due to activation of protein kinase A and subsequent covalent modification of presynaptic ion channels or synaptic proteins. Here we show that presynaptic cAMP generation via serotonin receptor activation directly modulated hyperpolarization-activated cation channels (Ih channels) in axons. This modulation of Ih produced an increase in synaptic strength that could not be explained solely by depolarization of the presynaptic membrane. These studies identify a mechanism by which cAMP and Ih regulate synaptic plasticity.
Serotonin is an important neuromodulator of synaptic transmission in many phyla1–7. In crustaceans, serotonin acts as a neurohormone; on binding to a Gs-coupled receptor8, it strongly enhances neuromuscular transmission by increasing the number of quanta released per action potential9–11. Studies on both the inhibitor (GABAergic) and excitor (glutamatergic) nerve innervating the muscle have implicated two distinct processes: serotonin increases the absolute number of vesicles available for transmitter release12, and serotonin increases the kinetics of release from the inhibitor nerve13. Serotonin alters neither resting presynaptic [Ca2+]i nor calcium influx during an action potential in crayfish nerve terminals 13,14 . Its actions seem to be mediated by at least two second-messenger systems, one involving phospholipase C (PLC) and another involving adenylyl cyclase8,15. Serotonin enhancement of transmission is blocked by presynaptic injection of a selective PLC inhibitor8. The downstream messenger and its target that mediate this enhancement are uncertain, but this pathway may involve cAMP. Compounds increasing [cAMP]i can mimic and potentiate serotonin action15,16, and serotonin increases cAMP levels when added to lobster neuromuscular preparations, although a pre- or postsynaptic locus for cAMP production was undetermined17. In addition, presynaptic injection of an adenylyl cyclase inhibitor reduces serotonin enhancement15. Here we show that cAMP generation is an important component of serotonin enhancement of synaptic transmission, and furthermore, that the target for cAMP is presynaptically located Ih channels.
RESULTS Serotonin-induced enhancement involves cAMP We recorded excitatory junction potentials (EJPs) from crayfish muscle cells at the neuromuscular junction while stimulating innervating glutamatergic axons. Superfusion of serotonin (300 nM, 25 min) resulted in a maximal increase of 310% in EJP nature neuroscience • volume 3 no 2 • february 2000
amplitude (Fig. 1a) with an EC50 of 60 ± 19 nM and a Hill coefficient of 1.14 ± 0.22 (n = 4; Fig. 1d). Simultaneous intracellular recording of axon membrane potential revealed an associated depolarization of the resting potential by ∼10 mV (Fig. 1a and c) and a slight reduction in action potential amplitude and the area beneath its voltage trace, consistent with previous reports8,15. Forskolin, an activator of adenylyl cyclase, partially mimicked the effects of serotonin (Fig. 1b and c), maximally increasing EJP amplitude by 120% (EC50, 19 ± 10 µM; Hill slope, 1.09 ± 0.26; n = 3), and depolarizing the axon membrane by ∼7 mV. Amplitude of the action potential and area beneath its trace were also slightly reduced. The membrane-permeable cAMP analog 8-BrcAMP (300 µM) mimicked the effect of forskolin, enhancing EJP amplitude by 80 ± 12% (n = 6). We next sought to determine the role of endogenous cAMP generation in serotonin-induced synaptic enhancement. The phosphodiesterase inhibitor IBMX prevents breakdown of cAMP, so we would expect it to potentiate serotonin enhancement if cAMP were generated after serotonin receptor activation. Application of a maximal concentration of serotonin (300 nM) increased EJP amplitude by 304 ± 46%. After washout (2 h) to allow EJP amplitude to return to pre-drug levels, subsequent incubation in a low concentration of IBMX (1 µM) increased EJP amplitude by 30 ± 19%. When this EJP amplitude was taken as the new baseline, application of serotonin in the continued presence of IBMX potentiated EJP enhancement (457 ± 122% increase in EJP amplitude, n = 5, p < 0.1, Fig. 1e). A second application of serotonin in the absence of IBMX produced no increase in EJP amplitude over that seen during the first application (p > 0.1, n = 4). As IBMX is also a nonselective adenosine-receptor antagonist, we investigated whether the observed potentiation might be due to inhibition of adenosine receptors rather than inhibition of phosphodiesterase. At a concentration 100-fold higher than that used for IBMX, application of the nonselective adenosine receptor antagonist, 8-(p-sulfophenyl)-theophylline (8-PST, 100 µM; n = 5), similarly increased basal EJP amplitude by 43 ± 16% 133
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
(IBMX response, 30 ± 19%, n = 5). However, in contrast to IBMX, 8-PST did not potentiate the serotonin (300 nM) response; the increase in EJP amplitude induced by serotonin in the presence of 8-PST was not different from that elicited by serotonin in the absence of 8-PST (3 ± 11% difference; p > 0.05, n = 5). Therefore, IBMX potentiation of the serotonin-induced enhancement seems to result from phosphodiesterase inhibition, although the effect of IBMX alone on EJP amplitude may be due to a nonspecific action, or even to inhibition of adenosine receptors. Serotonin and forskolin act presynaptically The locus of action of both serotonin and forskolin (and hence cAMP generation) was examined using analysis of miniature EJPs (mEJPs). In Normal Van Harrevald’s solution containing TTX (1 µM), the mean frequency of mEJPs recorded over a 30-minute period was 0.31 ± 0.1 Hz with a mean amplitude of 254 ± 36 µV (n = 12). After incubation for 20 minutes in either serotonin (1 µM) or forskolin (30 µM), the same muscle fiber was recorded for 30 minutes in the presence of the drug. In 5 of 6 paired experiments, serotonin induced a significant increase in frequency (p < 0.05, Kolmogorov-Smirnov test) but not amplitude of mEJPs (Fig. 2a and b), with a mean increase in frequency of 64 ± 11% 134
forskolin
8-BrcAMP
forskolin
8-BrcAMP
serotonin
serotonin
% increase control EJP amplitude
Fold increase in EJP amplitude
© 2000 Nature America Inc. • http://neurosci.nature.com
Percent increase EJP amplitude
Axon depolarization (mV)
Fig. 1. Serotonin and forskolin c a Control Serotonin (300 nM) enhance synaptic transmission. (a, b) Intracellular recording of axonal action potentials (APs, Pre) and muscle excitatory junction potentials (EJPs; Post) Post before (control) and after application of serotonin (300 Pre nM, 25 min; a) and forskolin (30 µM, 25 min; b). Each trace is the average of all EJPs/APs recorded for 1 min at 2-Hz Forskolin (30 µM) Control stimulation. Scale bars, 25 ms b and 1 mV (Post) or 30 mV (Pre). (c) Bar charts summarizing the axonal depolarization Post (top) and enhancement of EJP amplitude (bottom) induced by serotonin (300 nM), forskolin Pre (30 µM) or 8-Br cAMP (300 µM); n = 4–12. (d) Cumulative concentration–response curves for serotonin () and forskolin d (∆). The lower maximal e increase in EJP amplitude with IBMX (1 µM) forskolin than with serotonin demonstrates that adenylyl serotonin (300 nM) cyclase activation cannot entirely account for serotonininduced enhancement. Each point represents the mean ± s.e. of four experiments. (e) Time course of serotonin (300 nM)-induced enhancement of EJP amplitude (). After EJPs returned to control amplitudes following washout of serotonin, each log10 [drug] (log M) Time (min) preparation was incubated for 25 min with a low concentration of the phosphodiesterase inhibitor IBMX (1 µM). IBMX alone resulted in a small enhancement of EJP amplitude (normalized to control in graph). A second serotonin application was potentiated in the presence of IBMX (n = 5, ). This effect might be explained by increased cAMP generation over control levels in response to serotonin application.
(Fig. 2b; p < 0.05, Student’s t-test). Forskolin significantly increased frequency in 3 of 6 experiments (Kolmogorov-Smirnov test, p < 0.05) with a mean increase in frequency of 42 ± 33% and no increase in amplitude of mEJPs (p > 0.1, Student’s t-test, Fig. 2b). Consistent with serotonin’s enhancement of the size of the vesicle pool12, this finding supports the assumption that the locus of action of both serotonin and forskolin is presynaptic. PKA is not involved The downstream effects of cAMP at the crayfish neuromuscular junction have previously been attributed to activation of PKA 15 . We tested the effects of two membrane-permeable inhibitors of PKA on the enhancement induced by serotonin and 8-Br-cAMP. A submaximal concentration of serotonin (100 nM, 25 min) elicited an increase in EJP amplitude of 144 ± 24%. In the presence of 30 µM H-7, which should fully inhibit PKA, PKC and PKG (Ki = 3–6 µM18,19), a second application of serotonin resulted in an amplitude increase no different from the control response (148 ± 33%, n = 4, p > 0.05). H-7 was similarly ineffective against the increase induced by 8-Br-cAMP (8Br-cAMP alone, 74 ± 23%; 8-Br-cAMP plus H-7, 95 ± 38%; n = 3; p > 0.05). However, H-7 (30 µM) prevents an unrelated nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Presynaptic Ih channels are modulated by cAMP Depolarization of the axon by forskolin, 8-Br-cAMP and serotonin (Fig. 1a–c) suggests that presynaptic Ih channels may be targets for cAMP. Indeed, modulation of Ih channels by the direct binding of cyclic nucleotides (including Rp-8-Br-cAMPS20) and subsequent
shifts of the activation curve to more depolarized potentials20–25 would explain depolarization on addition of cAMP analogs8,15. The presence of Ih channels in the crayfish excitor axon was investigated by intracellular injection of hyperpolarizing current pulses (500 ms, –5 to –50 nA) into the axon. Upon hyperpolarization of the membrane beyond resting potential, Ih should become activated, typically producing a ‘depolarization sag’ back toward the resting potential, whereas termination of the pulse results in a transient depolarizing overshoot of the original resting potential (after-depolarization potential; ADP)25,26. ADPs were produced by injecting current pulses of different amplitudes (Fig. 4). With large current injections, the ADP was of sufficient amplitude to initiate firing of action potentials, as demonstrated for Ih channels in many neurons25. When the Ih blocker Cs+ (1 mM) was applied to the preparation, resting membrane potential hyperpolarized by approximately 4 mV, and ADP amplitude was significantly reduced (Fig. 4a). Injection of between –5 and –50 nA of current elicited ADPs (Fig. 4b; n = 6) that were blocked by Cs+ (n = 3) or the specific Ih blocker ZD7288 (ref. 27; n = 3). These data not only demonstrate the presence of Ih channels in excitor axons, but also suggest that these channels contribute to the axon’s resting potential. However, it should be noted that,
a Control
Serotonin (1 µM)
Fig. 2. Serotonin and forskolin act at a presynaptic locus to enhance synaptic transmission. (a) 20-s sample traces of miniature EJPs, measured in NVH solution containing TTX (1 µM) before (control) and after a 20-min incubation in serotonin (1 µM). Scale bars, 0.5s, 0.3 mV. (b) Left, cumulative probability plot for inter-event interval after analysis of mEJPs recorded for 30 min in NVH solution alone (____) or in the presence of serotonin (----) indicates significantly higher event frequency in serotonin (0.57 Hz versus 0.33 Hz, control). Right, superimposed average mEJPs with and without serotonin show similar amplitudes. (c) Percent change in both mean frequency (left) and mean amplitude (right) of mEJPs after application of either forskolin (open bars) or serotonin (filled bars) Each bar represents the mean ± s.e. of six experiments. Both forskolin and serotonin application increased mEJP frequency without significantly altering amplitude.
b Cumulative percent
© 2000 Nature America Inc. • http://neurosci.nature.com
presynaptic phorbol ester-induced potentiation of transmission at the crayfish neuromuscular junction (V.B. and R.S.Z., unpublished observation), demonstrating that this compound permeates the axon sufficiently to inhibit PKC. In addition to H-7, we tested the highly specific, cell-permeable PKA inhibitor Rp-8-Br-cAMPS. Incubation with Rp-8-BrcAMPS (300 µM) alone caused a 40 ± 13% increase in EJP amplitude, suggesting that this cAMP analog may mimic cAMP itself. When serotonin was also added, EJP amplitude increased by 292 ± 68% of pre-drug amplitude, not significantly different from the paired response with serotonin alone (324 ± 125%, n = 3; Fig. 3a). Similar effects of Rp-8-Br-cAMPS were found against 8-Br-cAMP-induced increases in EJP amplitude (Fig. 3b). Because Rp-8-Br-cAMPS is a cAMP analog, and it increased EJP amplitude significantly, these results suggest that the target of cAMP may be a cyclic nucleotide-binding effector other than PKA.
Control
100 µV
Serotonin (1 µM) 20 ms Inter-event interval (s)
c
nature neuroscience • volume 3 no 2 • february 2000
Percent change in mean frequency
Percent change in mean amplitude
Forskolin Serotonin
135
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Percent increase EJP amplitude
whereas ADPs elicited by current injection up to and including –30 nA could be blocked effectively, ADPs elicited by larger current injections were not completely blocked by either Cs+ or ZD7288 (Fig. 4a and b), suggesting that ADPs evoked by injection of more than –30 nA may involve conductances other than Ih channels. To determine whether Ih channels were modulated by cAMP, we attempted to block the serotonin- and forskolin-induced depolarization of the axon (Fig. 1a and b) using Cs+ and ZD7288. Application of serotonin (300 nM) resulted in a maximum axon depolarization of 9.5 ± 0.75 mV from a mean resting membrane potential of –71 ± 1 mV (n = 12; Fig. 5a) within 16 minutes of serotonin application. Addition of Cs+ (3 µM–3 mM) reversed this depolarization in a concentration-dependent manner (IC50, 260 ± 20 µM; Hill coefficient, 1.26 ± 0.05; n = 5, Fig. 5b). A slight broadening of the action potential and an increase in area beneath the voltage trace was observed in Cs+, consistent with additional block of a potassium conductance. However, addition of the potassium-channel blocker Ba2+ (1 mM) to the nerve reproduced the
a
effects on the action potential seen with Cs+, but did not affect serotonin-induced depolarization (Fig. 5a). ZD7288 (100 nM–100 µM; 25 min) potently reduced serotonin-induced depolarization of the axon, with an IC50 similar to that for its action on I h channels 27,28 (IC 50, 6 ± 2 µM; Hill coefficient, 1.19 ± 0.01; n = 4, Fig. 5b). Serotonin seemed to alter Ih activity through cAMP generation, as application of forskolin (30 µM) also produced axon depolarization of 6.3 ± 0.6 mV from a mean resting potential of –71 ± 1.4 mV (n = 8, Fig. 5c and d). The significantly smaller size of the depolarization with forskolin than with serotonin (∼10 mV) probably resulted from the barely submaximal concentration of forskolin used (Fig. 1d). Incubation with Cs + (1 mM, n = 4) or ZD7288 (30 µM, n = 4) abolished the depolarization induced by a second application of forskolin (Fig. 5c and d). In summary, we demonstrated that cAMP generated in the axon acts on Ih, resulting in depolarization with a time course paralleling that of synaptic enhancement.
b Iinj
RMPaxon
20 nA
40 nA Peak amplitude ADP (mV)
© 2000 Nature America Inc. • http://neurosci.nature.com
Percent increase EJP amplitude
Fig. 3. Rp-8Br-cAMPS elevates a b EJP amplitude and does not sigRp-8-Br-cAMPS nificantly block serotonin Rp-8-Br-cAMPS enhancement of transmission. serotonin 8-Br-cAMPS (a) Time course of the increase of EJP amplitude in response to serotonin (100 nM; ). After serotonin was washed out and EJP amplitude reached a steady baseline, preparations were incubated with the membrane-permeable specific PKA inhibitor Rp-8Br-cAMPS (300 µM). Surprisingly, this incubation enhanced EJP amplitude (,*) by Time (min) Time (min) approximately 50% over control. Serotonin-induced enhancement was affected little by the PKA inhibitor (). (b) Time course of the increase of EJP amplitude by the membrane-permeable cAMP analog 8-Br-cAMP (, 300 µM). After washout of 8-Br-cAMP, EJP amplitude reached a steady baseline, and preparations were incubated with Rp-8Br-cAMPS (300 µM). Again, this incubation increased EJP amplitude 48 ± 4% over control (,*) Addition of 8-Br-cAMP together with Rp-8Br-cAMPS resulted in a slightly smaller increase in EJP amplitude (78 ± 7%; ) than 8-Br-cAMP applied alone (120 ± 30%, ).
Hyperpolarizing pulse (nA)
Fig. 4. Ih channels are involved in maintenance of resting membrane potential, and Ih activation results in anomolous membrane rectification in excitatory axons. (a) Injection of axons with hyperpolarizing current (500 ms) resulted in after-depolarizing potentials (ADPs; traces in black). Resting membrane potential of the axon (dashed line) was –66 mV. Membrane responses during the pulse were truncated. With large hyperpolarizing pulses (typically ≥ 40 nA), the ADP was sufficient to reach threshold for action potential generation (APs truncated in trace). Scale bar, 2 s, 10 mV. In the same axon, resting membrane potential became relatively hyperpolarized in the Ih channel blocker Cs+ (1 mM; compare gray traces with dashed line), and ADP amplitudes in response to hyperpolarizing pulses were reduced (gray traces). (b) Plots of peak ADP amplitude versus size of injected hyperpolarizing current in controls (, n = 6), with Cs2+ (, 1 mM, n = 3) or with ZD7288 (, 30 µM, n = 3). 136
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
Modulation of Ih by cAMP results in synaptic enhancement To investigate the involvement of Ih modulation in synaptic enhancement, we studied the increase of EJP amplitude by serotonin, forskolin and 8-Br-cAMP in the absence and presence of ZD7288 (30 µM) or Cs+ (1 mM), with Ba2+ (1 mM) as a control. In the absence of any other drug, serotonin (100 nM) caused a 2.9 ± 0.3-fold increase in EJP amplitude (control response; n = 13). Two hours later, recordings from the same muscle cells incubated in Cs+ (1 mM) 10 minutes before and during a second serotonin application showed a 43 ± 7% reduction compared with control responses to serotonin (1.8 ± 0.2-fold increase in EJP amplitude; p < 0.05, n = 6), whereas application of 1 mM Ba2+ before and during a third serotonin application insignificantly increased EJP amplitude 17 ± 13% over controls, consistent with the slight widening of the action potential we observed (n = 6; Fig. 6a and b). A 25-minute application of ZD7288 before and during serotonin application was as effective as Cs+ in reducing synaptic enhancement, decreasing the response to serotonin by 42 ± 13% from the control (n = 7, p < 0.05; Fig. 6a). Neither Cs+ nor ZD7288 applied on its own reduced basal EJP amplitude (n = 4 each). Both forskolin’s (30 µM) and 8-Br-cAMP’s (300 µM) enhancement of EJP amplitude (1.4 ± 0.2-fold increase, n = 9 and 0.8 ± 0.1-fold increase, n = 6, respectively) were markedly
blocked in the presence of ZD7288 (30 µM), which decreased synaptic enhancement by 67 ± 6% (Fig. 6c) and 70 ± 18% (Fig. 6d) relative to the respective control responses. Enhancement of EJP amplitude by 8-Br-cAMP was blocked by Cs+ equally well (82 ± 2% reduction of the control response, n = 3). However, Cs+ was less effective in blocking forskolin enhancement, reducing the response to only 31 ± 15% of the control response (n = 3). Although the reason for this is not obvious, Cs+ blockade of a potassium conductance in these cells may have induced a depolarization that counteracted the effect of blocking Ih to a greater extent than observed in other experiments. It is conceivable that the reduction of the serotonin and forskolin response by ZD7288 and Cs+ ions may have been a result only of the membrane hyperpolarization produced by these agents, rather than by a specific block of an Ih conductance. We felt this was unlikely, as hyperpolarizing the axon by ∼5 mV by manipulating extracellular potassium has no effect on either serotonin-induced axonal depolarization or serotonin-induced synaptic enhancement14,29. Nevertheless, we eliminated hyperpolarization of the axon in the presence of ZD7288 (30 µM) by slightly elevating extracellular potassium concentration to 6.75–7.0 mM (Fig. 7a). Even with the offset of hyperpolarization afforded by increased [K + ] e ,
c
a Ba2+
serotonin
serotonin
Cs+ (1 mM) forskolin
forskolin
RMP axon(mV)
RMP axon(mV)
serotonin
Cs+
Time (min)
Time (min)
d
b
ZD7288 (30 µM) forskolin
forskolin
RMP axon(mV)
Depolarization of axon (mV)
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
log10 [Ih inhibitor] (log M)
Time (min)
Fig. 5. Ih modulation by cAMP generation results in axon depolarization. (a) Application of serotonin (300 nM) to axons resulted in an approximately 10-mV membrane depolarization (n = 5, ). After washout of serotonin, membrane depolarization slowly reversed to pre-serotonin levels. Application of Cs+ (1 mM) to the axon resulted in a rapid membrane hyperpolarization of approximately 5 mV. Subsequent application of serotonin in the presence of Cs+ was ineffective in eliciting a membrane depolarization. After washout of Cs+, incubation with Ba2+ (1 mM) affected neither resting membrane potential nor subsequent depolarization in response to serotonin (n = 4; typical s.e., ± 1.5 mV). (b) Cumulative concentration–inhibition curves for Cs+ (; n = 3 separate experiments) and the irreversible Ih blocker ZD7288 (; n = 4) against axon depolarization induced by serotonin (300 nM). Each point represents the mean ± s.e. (c, d) Forskolin (30 µM) mimics serotonin at the axon, suggesting that cAMP generation is responsible for increased Ih activation and resulting depolarization. The effects of forskolin can be blocked by either Cs2+ (c; 1 mM) or ZD7288 (d; 30 µM). nature neuroscience • volume 3 no 2 • february 2000
137
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Axonal hyperpolarization enhances synaptic transmission Our results thus far implicated cAMP modulation of Ih channels as a vital component of the increase in synaptic strength observed on addition of either serotonin or forskolin. We extended this observation to see whether voltage-gated activation of Ih channels per se was sufficient to increase synaptic transmission at the crayfish neuromuscular junction. First, the fluorescent dye Fura-2 (17 mM in 200 mM KCl) was iontophoresed (–10 nA, 10 min) into the axon via a microelectrode. Diffusion of the dye along the length of the axon allowed visualization of small tertiary branches and boutons innervating individual muscle fibers. Using a new intracellular electrode (3 M KCl), we reimpaled the axon within
a
1 mM Ba2+ 1 mM Cs + ZD7288 (30 µM)
forskolin, control 1 mM Ba2+ 1 mM Cs +
c
d
ZD7288 Percent of control 8-Br-cAMP increase 8-Br-cAMP, control
1 mM Ba2+ Cs +
ZD7288
serotonin
Percent increase EJP amplitude
Percent of control forskolin increase
1 mM Cs+/Ba2+
Percent increase EJP amplitude
control 5HT enhancement
several hundred microns of boutons innervating a muscle fiber, which was also impaled with a microelectrode. We then simultaneously recorded both evoked action potentials (2 Hz) in the excitor nerve and subsequent EJPs in the muscle (Fig. 8a). After 10 minutes, stimulation was stopped and the axon hyperpolarized by injection of –30 nA for 1 minute via the intracellular electrode, a protocol that elicits a large ADP, but is not sufficient to induce spontaneous firing of action potentials (Fig. 4). The increased time of current injection used in this experiment (1 min versus 0.5 s in Fig. 4) did not significantly affect the amplitude of the ADP (13 ± 6 mV after 1-min and 16 ± 4 mV after 0.5-s current injection) or its sensitivity to ZD7288 (79 ± 21% block and 87 ± 18% block, respectively; n = 3), suggesting that this prolonged current protocol elicited an ADP indicative mainly of Ih channel activation. During axon hyperpolarization, we often noted an increase in the number of spontaneous EJPs (Fig. 8a) which was not observed previously using methods that polarize large axonal branches30. If no increase in spontaneous events was detected during hyperpolarization, it was assumed that the hyperpolarizing electrode was too far from boutons to elicit a response in the recorded muscle fiber, and the experiment was discounted (4 of
b
Percent of control 5HT increase
Percent increase EJP amplitude
© 2000 Nature America Inc. • http://neurosci.nature.com
forskolin-induced synaptic enhancement after ZD7288 treatment was reduced to the same extent as without elevating [K+]e (68 ± 23% reduction, n = 3, Fig. 7b). In summary, pooled results from the above experiments show that Ih activation by cAMP was responsible for 62 ± 7% (n = 18) of the cAMP-induced synaptic enhancement, and activation of Ih via cAMP generation accounted for 43 ± 6% (n = 13) of the serotonin-induced enhancement of synaptic strength.
Time (min) forskolin (30 µM)
Time (min) 8-Br-cAMP (300 µM)
Time (min)
138
Fig. 6. Inhibition of Ih channels resulted in a reduction of synaptic enhancement by serotonin, forskolin and 8-Br-cAMP. (a) Effects of Ba2+ (1 mM) and the Ih blockers Cs+ (1 mM) or ZD7288 (30 µM) on EJP amplitude enhancement by serotonin (100 nM; upper), forskolin (30 µM; middle, gray bars) or 8-Br cAMP (300 µM; lower) To allow visual comparison of the percent inhibition of synaptic enhancement by either Cs+ or ZD7288, enhancements with serotonin, forskolin or 8Br-cAMP alone (control enhancement) were normalized to 100%. (b–d) Data from which bar charts were generated. (b) Time course of the percent increase in EJP amplitude with serotonin alone (100 nM; ) or after concurrent incubation with Cs+ (1 mM; ) or Ba2+ (1 mM, _____). (c, d) Percent increase in EJP amplitude during application of forskolin (c; ) or 8-Br-cAMP (d; ) alone or after a 30-min pre-incubation with ZD7288 (30 µM, ). Each point represents the mean ± s.e. of 4–7 different experiments. nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
b
Percent increase in EJP amplitude
after determining the postsynaptic control response to forskolin (b, ). Resulting presynaptic membrane hyperpolarization was then offset by stepwise increases in extracellular potassium to return the axon to its original resting potential. The recovery of hyperpolarization when the [K+]e was returned to normal (5.4 mM) demonstrates the irreversibility of Ih block by ZD7288. (b) After determining the postsynaptic control response to forskolin (), ZD7288 was applied and the resulting hyperpolarization of the axon membrane potential offset back to the original resting potential (see a) before recording the response to forskolin from a different muscle fiber in the same preparation (, n = 3). ZD7288 still reduced forskolininduced synaptic enhancement under these conditions.
DISCUSSION
Neuronal Ih channels subserve fundamental physiological functions such as contribution to membrane potential31–34, integration of synaptic input to neurons 35 and the rhythmicity of various brain regions36–39. Binding of cAMP to Ih results in a concentration-dependent shift of the activation curve to more depolarized voltages through a phosphorylation-independent allosteric interaction with the channel40,41. Thus receptors both positively and negatively coupled to adenylyl cyclase can shift Ih activation by up to ± 20 mV25, and β-adrenoceptors23, serotonin receptors23,42,43, A1 adenosine receptors44 and µ-opioid receptors21 regulate Ih in this way. The chan-
12). After axon hyperpolarization, action potentials and subsequent EJPs were again evoked at two Hz. EJP amplitude significantly increased following hyperpolarization, increasing an average of 54 ± 11% by 10–20 minutes after current injection (Fig. 8a and b; p < 0.05, n = 8). In separate experiments, ZD7288 (30 µM) was applied for 30 minutes before and during the –30 nA hyperpolarization of the axon (Fig. 8b). a Before hyperpolarization Before hyperpolarization 10 min after hyperpolarization Again, individual experiments were abandoned if spontaneous release was not seen During hyperpolarization during the hyperpolarizing pulse, although Post Post this was rare (1 of 7) in the presence of ZD7288. The increase in spontaneous Pre Pre 1 mV release observed during hyperpolarization 0.5 s with ZD7288 probably indicated that hyperpolarizing current pulses applied during Ih block resulted in greater changes in potential compared with those in control trials. b Hyperpolarization EJP amplitude sometimes increased slight(–30 nA, 1 min) ly (average 11 ± 8%) and transiently between 1 and 5 minutes after the termination of the pulse, correlating positively with the level of spontaneous activity during the hyperpolarization, although this was not quantified further. However, ZD7288 completely prevented the enhancement of EJP amplitude between 10 and 20 minutes after current injection (2 ± 5% reduction from basal amplitude, n = 6, significantly different Time (min) from the control trials; p < 0.001, Student’s Fig. 8. Brief activation of Ih channels by hyperpolarization is sufficient to induce long-lasting unpaired t-test). enhancement of EJP amplitude. (a) Intracellular recording of axonal action potentials (APs; pre) It should be noted that, although this and muscle excitatory junction potentials (EJPs; post) before (control) and 10 minutes after experiment is unavoidably compromised by hyperpolarizing current injection (1 min, –30 nA) into the axon to activate I channels. Each trace h the probable difference in axon membrane is the average of all EJPs/APs recorded for 1 min at 2-Hz stimulation. Scale bars, 25 ms and 1 mV potential change elicited by the current pulse (post) or 25 mV (pre). Spontaneous EJPs increase upon hyperpolarization (middle panel). with or without Ih channel block, the pre- (b) Time course of EJP amplitude before, during and after hyperpolarization (–30 nA, 1 min) to vention of any increase by ZD7288 is incon- activate presynaptic Ih channels with ZD7288 (; 30 µM; n = 6) or without ZD7288 (; n = 8). Percent increase EJP amplitude
© 2000 Nature America Inc. • http://neurosci.nature.com
RMPaxon (mV)
sistent with the notion that EJP enhancement is a result of hyperpoforskolin larization per se. Indeed, if hyperpoKCI 5.4 mM 6.5 mM 7 mM 5.4 mM larization independent of I h ZD7288 activation mediated the enhancement of EJP amplitude, one would expect a greater increase after ZD7288 application, where blockade of Ih conductance would increase the hyperpolarization induced by current injection. We therefore conclude that a relatively brief Ih channel activation, independent of cAMP modTime (min) Time (min) ulation, is also capable of eliciting a Fig. 7. Reversal of the ZD7288-mediated axonal hyperpolarization does not affect ZD7288 block of more prolonged synaptic enhanceforskolin-induced synaptic enhancement. (a) The axon was impaled, and ZD7288 (30 µM) was applied ment.
nature neuroscience • volume 3 no 2 • february 2000
139
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
nels we describe were similar to other reported Ih channels based on their activation by hyperpolarization, the contribution made to axonal resting potential, their increased activation by cAMP and their selective pharmacological block by both Cs + and ZD7288. The Ih current is a mixed cation current (Na+/K+)25, and under physiological conditions, current is carried predominantly by the movement of sodium ions. In the crayfish axon, this also seems to be the case, as serotonin-induced depolarization of membrane potential was prevented when external sodium was replaced with choline15. The mechanism by which serotonin-induced activation of Ih channels in the axon results in an increase in the total number of vesicles available for release12 remains elusive. It is clear from previous studies that the amplitude of depolarization per se elicited by serotonin or forskolin is insufficient to account for the enhancement of neurotransmission, as depolarizing the axon by the same amount using either high [K+]14,29 or current injection through intracellular recording electrodes45 could not mimic the increase in synaptic strength. In addition, the observation that EJP amplitude remains elevated for up to 20 minutes after a relatively brief (1 minute) axonal hyperpolarization would suggest that Ih activation is required only for initiating a downstream process resulting in synaptic enhancement. Synaptic enhancement after axon hyperpolarization is observed not only in crayfish30 but also in vertebrate junctions46. Before knowledge of Ih channels, either a prolongation of the action potential30 or a hyperpolarization-dependent mobilization of vesicles was assumed responsible30,47. As we did not stimulate the nerve and record EJPs during hyperpolarization, and action potentials were unaltered after hyperpolarization, the former hypothesis can be rejected. However, active Ih-dependent mobilization of vesicles from non-releasable to releasable pools represents an attractive possibility, and the role of microtubule and actin transport pathways in this cAMP-induced enhancement are being investigated. Ih clearly can be included with other presynaptic voltage- and ligand-gated ion channels modulated by neurotransmitters to inhibit or facilitate transmission. The many reports of Ih channels in vertebrate and invertebrate axons42,47–49 suggest physiological importance of cAMP-induced Ih modulation in regulating synaptic strength in a variety of organisms.
METHODS Crayfish (Procambarus clarkii, 2–3 inches) were obtained from Niles Biological (Sacramento, California). Preparation of the innervated dactyl opener muscle of the first walking leg is described14. Autotomized legs were continuously superfused by a gravity-fed perfusion system with Normal Van Harrevald’s solution, containing 195 mM NaCl, 13.5 mM CaCl2, 5.4 mM KCl, 2.6 mM MgCl2 and 10 mM Na-HEPES at pH 7.4 and 14–17°C. Serotonin, H-7, 8-(phenylsulfonyl)-theophylline and 8Br-cAMP were obtained from Sigma; Fura-2 from Molecular Probes (Eugene, Oregon); and ZD7288 from Tocris Cookson (Ballwin, Missouri). All other drugs were from Calbiochem (La Jolla, California). All paired control experiments contained final concentrations of DMSO equal to those used for drug delivery. Electrophysiology. Sharp electrodes were used to impale both proximal muscle fibers (electrode resistance, 12–25 MΩ) and/or either primary or secondary branches of the excitor nerve axon (beveled electrode resistance, 25–45 MΩ). Excitor nerves were stimulated (2 Hz) during recording using a suction electrode containing the excitor axon freed from the meropodite segment of the leg. Signals were amplified (Neuroprobe 1600 Amplifier, A-M systems Carlsborg, Washington), filtered at 2 kHz, and digitized at 5 kHz and the average of all EJPs elicited each minute was saved to computer using pClamp7 software (Axon Instruments Foster 140
City, California). EJP amplitudes were measured off-line (Clampfit 6.05, Axon Instruments). For miniature EJP recording, beveled sharp electrodes (resistance 5–10 MΩ) were used to continuously acquire recordings subsequently filtered at 1 kHz, digitized at 2.5 kHz and analyzed off-line using Minianalysis Program version 4.0.1 (Synaptosoft, Leonia, New Jersey). Data presentation and statistical analysis. As control EJP amplitudes were extremely variable from fiber to fiber, results were expressed as percent change from control EJP amplitude, taken as the average EJP amplitude over ten minutes of continuous recording in the absence of drug. Data are plotted as mean ± s.e. percent change from this control level. When effects of different drugs were tested within a single muscle fiber, results were analyzed by Student’s paired t-test; the Kolmogorov-Smirnov test was used to compare differences in cumulative probability for analysis of mEJPs. Significance was assumed if p < 0.05, unless otherwise stated.
ACKNOWLEDGEMENTS We thank Russell English for technical assistance. This work was supported by NSF Grant IBN-9722826.
RECEIVED 24 AUGUST; ACCEPTED 30 NOVEMBER 1999 1. Sugita, S., Goldsmith, J. R., Baxter, D. A. & Byrne, J. H. Involvement of protein kinase C in serotonin-induced spike broadening and synaptic facilitation in sensorimotor connections of Aplysia. J. Neurophysiol. 68, 643–651 (1992). 2. Hori, Y., Endo, K. & Takahashi, T. Long-lasting synaptic facilitation induced by serotonin in superficial dorsal horn neurones of the rat spinal cord. J. Physiol. (Lond.) 492, 867–876 (1996). 3. Sun, Z. Y. & Schacher, S. J. Binding of serotonin to receptors at multiple sites is required for structural plasticity accompanying long-term facilitation of Aplysia sensorimotor synapses. J. Neurosci. 18, 3991–4000 (1998). 4. Schuman, E. M. & Clark, G. A. Synaptic facilitation at connections of Hermissenda type B photoreceptors. J. Neurosci. 14, 1613–1622 (1994). 5. Stäubli, U. & Otaky, N. Serotonin controls the magnitude of LTP induced by theta bursts via an action on NMDA-receptor-mediated responses. Brain Res. 643, 10–16 (1994). 6. Mintz, I. & Korn, H. Serotonergic facilitation of quantal release at central inhibitory synapses. J. Neurosci. 11, 3359–3370 (1991). 7. Mitoma, H., Kobayashi, T., Song, S. Y. & Konishi, S. Enhancement by serotonin of GABA-mediated inhibitory synaptic currents in rat cerebellar Purkinje cells. Neurosci. Lett. 173, 127–130 (1994). 8. Dixon, D. & Atwood, H. L. Phosphatidylinositol system’s role in serotonininduced facilitation at the crayfish neuromuscular junction. J. Neurophysiol. 62, 239–246 (1989). 9. Dudel, J. Facilitatory effects of 5-hydroxy-tryptamine on the crayfish neuromuscular junction. Naunyn Schmiedebergs Arch. Pharmacol. 249, 515–528 (1965). 10. Fischer, L. & Florey, E. Modulation of synaptic transmission and excitationcontraction coupling in the opener muscle of the crayfish, Astacus leptodactylus, by 5-hydroxytryptamine and octopamine. J. Exp. Biol. 102, 187–198 (1983). 11. Glusman, S. & Kravitz, E. A. The action of serotonin on excitatory nerve stimulation in lobster nerve-muscle preparations. J. Physiol. (Lond.) 325, 223–241 (1982). 12. Wang, C. & Zucker, R. S. Regulation of synaptic vesicle recycling by calcium and serotonin. Neuron 21, 155–167 (1998). 13. Vyshedskiy, A., Delaney, K. & Lin, J.-W. Neuromodulators enhance transmitter release by two separate mechanisms at the inhibitor of crayfish opener muscle. J. Neurosci. 18, 5160–5169 (1998). 14. Delaney, K., Tank, D. W. & Zucker R. S. Presynaptic calcium and serotoninmediated enhancement of transmitter release at crayfish neuromuscular junction. J. Neurosci. 11, 2631–2643 (1991). 15. Dixon, D. & Atwood, H. L. Conjoint action of phosphatidylinositol and adenylate cyclase systems in serotonin-induced facilitation at the crayfish neuromuscular junction. J. Neurophysiol. 62, 1251–1259 (1989). 16. Enyeart, J. Cyclic AMP, 5-HT, and the modulation of transmitter release at the crayfish neuromuscular junction. J. Neurobiol. 12, 505–513 (1981). 17. Goy, M. F. & Kravitz, E. A. Cyclic AMP only partially mediates the actions of serotonin at lobster neuromuscular junctions. J. Neurosci. 9, 369–379 (1989). 18. Boulis, N. M. & Davis M. Blockade of the spinal excitatory effect of cAMP on the startle reflex by intrathecal administration of the isoquinoline sulfonamide H–8: comparison to the protein kinase C inhibitor H–7. Brain Res. 525, 198–204 (1990). 19. Quick, J., Ware, J. A. & Driedger P. E. The structure and biological activities of the widely used protein kinase inhibitor, H7, differ depending on the commercial source. Biochem. Biophys. Res. Commun. 187, 657–663 (1992). 20. Ingram, S. L. & Williams, J. T. Modulation of the hyperpolarization-activated current (Ih) by cyclic nucleotides in guinea pig primary afferent neurones. J. Physiol. (Lond.) 492, 97–106 (1996).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
21. Ingram, S. L & Williams, J. T. Opioid inhibition of Ih via adenylyl cyclase. Neuron 13, 179–186 (1994). 22. Tokimasa, T. & Akasu, T. Cyclic AMP regulates an inward rectifying sodiumpotassium current in dissociated bull-frog sympathetic neurones. J. Physiol. (Lond.) 420, 409–429 (1990). 23. Pape, H.-C. & McCormick, D. A. Noradrenaline and serotonin selectively modulate thalamic burst firing by enhancing a hyperpolarization-activated cation current. Nature 340, 715–718 (1989). 24. Di Francesco, D. & Mangoni, M. Modulation of single hyperpolarizationactivated channels (if) by cAMP in the rabbit sinoatrial node. J. Physiol. (Lond.) 474, 473–482 (1994). 25. Pape, H.-C. Queer current and pacemaker: the hyperpolarization-activated cation current in neurons. Annu. Rev. Physiol. 58, 299–327 (1996). 26. Lüthi, A. & McCormick, D. A. Periodicity of thalamic synchronized oscillations: the role of calcium mediated upregulation of Ih. Neuron 20, 553–563 (1998). 27. BoSmith, R. E., Briggs, I. & Sturgess, N. C. Inhibitory actions of ZENECA ZD7288 on whole-cell hyperpolarization activated inward current (If) in guineapig dissociated sinoatrial node cells. Brit. J. Pharmacol. 110, 343–349 (1993). 28. Harris, N. C. & Constanti A. Mechanism of block by ZD7288 of the hyperpolarization-activated inward rectifying current in guinea pig substantia nigra neurons in vitro. J. Neurophysiol. 74, 2366–2378 (1995). 29. Dixon, D. & Atwood, H. L. Crayfish motor nerve terminal’s response to serotonin examined by intracellular microelectrode. J. Neurobiol. 16, 409–424 (1985). 30. Dudel, J. The effect of polarizing current on action potential and transmitter release in crayfish motor nerve terminals. Pflügers Arch. 324, 227–248 (1971). 31. McCormick, D. A. & Pape, H.-C. Properties of a hyperpolarization-activated cation current and its role in rhythmic oscillation in thalamic relay neurones. J. Physiol. (Lond.) 431, 319–342 (1990). 32. Maccaferri, G., Mangoni, M., Lazzari, A. & DiFrancesco, D. Properties of the hyperpolarization-activated cation current in rat hippocampal CA1 pyramidal cells. J. Neurophysiol. 69, 2129–2136 (1993). 33. Pape, H.-C. Specific bradycardic agents block the hyperpolarization-activated cation current in central neurons. Neuroscience 59, 363–373 (1994). 34. Travagli, R. A. & Gillis, R. A. Hyperpolarization-activated currents, Ih and IKIR, in rat dorsal motor nucleus of the vagus neurons in vitro. J. Neurophysiol. 71, 1308–1317 (1994). 35. Magee, J. C. Dendritic Ih normalizes temporal summation in hippocampal CA1 neurons. Nat. Neurosci. 2, 508–514 (1999).
nature neuroscience • volume 3 no 2 • february 2000
36. Bal, T. & McCormick, D. A. What stops synchronized thalamocortical oscillations? Neuron 17, 297–308 (1996). 37. Leresche, N., Lightowler, S., Soltesz, I., Jassik-Gerschenfeld, D. & Crunelli, V. Low-frequency oscillatory activities intrinsic to rat and cat thalamocortical cells. J. Physiol. (Lond.) 441, 155–174 (1991). 38. Dekin, M. S. Inward rectification and its effects on the repetitive firing properties of bulbospinal neurons located in the ventral part of the nucleus solitarius. J. Neurophysiol. 70, 590–601 (1993). 39. Golowasch, J. & Marder, E. Ionic currents of the lateral pyloric neuron of the somatogastric ganglion of the crab. J. Neurophysiol. 67, 318–331 (1992). 40. DiFrancesco, D. Dual allosteric modulation of pacemaker (f) channels by cAMP and voltage in rabbit SA node. J. Physiol. (Lond.) 515, 367–376 (1999). 41. Lüthi, A. & McCormick D. Modulation of a pacemaker current through Ca2+-induced stimulation of cAMP production. Nat. Neurosci. 2, 634–641 (1999). 42. Bobker, D. H. & Williams, J. T. Serotonin augments the cationic current Ih in central neurons. Neuron 2, 1535–1540 (1989). 43. Kiehn, O. & Harris-Warrick, R. M. 5-HT modulation of hyperpolarizationactivated inward current and calcium-dependent outward current in a crustacean motor neuron. J. Neurophysiol. 68, 496–508 (1992). 44. Pape, H.-C. Adenosine promotes burst activity in guinea-pig geniculocortical neurones through two different ionic mechanisms. J. Physiol. (Lond.) 447, 729–753 (1992). 45. Wojtowicz, J. M. & Atwood, H. L. Presynaptic membrane potential and transmitter release at the crayfish neuromuscular junction. J. Neurophysiol. 52, 99–113 (1984). 46. Hubbard, J. I. & Willis, W. D. Hyperpolarization of mammalian motor nerve terminals. J. Physiol. (Lond.) 163, 115–137 (1962). 47. Birch, B. D., Kocsis, J. D., DiGregorio, F., Bhisitkul, R. B. & Waxman, S. G. A voltage and time-dependent rectification in rat dorsal spinal root axons. J. Neurophysiol. 66, 719–728 (1991). 48. Eng, D. L., Gordon, T. R., Kocsis, J. D. & Waxman, S. G. Current-clamp analysis of a time-dependent rectification in rat optic nerve. J. Physiol. (Lond.) 421, 185–202 (1990). 49. Grafe, P., Quasthoff, S., Grosskreutz, J. & Alzheimer, C. Function of the hyperpolarization-activated inward rectification in nonmyelinated peripheral rat and human axons. J. Neurophysiol. 77, 421–426 (1997).
141
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Synaptic activity modulates presynaptic excitability Teresa A. Nick1,2 and Angeles B. Ribera1 1
Department of Physiology and Biophysics, The University of Colorado Health Sciences Center, Denver, Colorado 80262, USA
2
Present address: Division of Biology, 216-76, California Institute of Technology, Pasadena, California 91125, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to T.A.N. (
[email protected])
Synaptic activity modulates synaptic efficacy and is important in learning and development. Here we show that development of excitability in presynaptic motor neurons required synaptic activation of postsynaptic muscle cells. Synaptic blockade broadened action potentials and decreased repetitive firing of presynaptic neurons. Consistent with these findings, synaptic blockade also decreased potassium-current density in the presynaptic cell. Application of neurotrophin-3, but not related neurotrophins, prevented these changes. Recordings from patches of somatic membrane indicated that modifications of presynaptic potassium and sodium currents occurred in a remote, nonsynaptic compartment. Thus, activity-dependent postsynaptic signals modulated presynaptic excitability, potentially regulating transmission at all synapses of the presynaptic cell.
Electrical activity regulates cell death, neurite outgrowth, neuronal differentiation and synaptic competition in the developing nervous system1–4. Although developmental changes in postsynaptic activity during synapse formation have been examined5, regulation of excitability in presynaptic cells during development and other forms of plasticity is not well understood. Moreover, it is completely unknown whether activation of postsynaptic cells regulates presynaptic excitability. This lack of understanding is particularly striking in light of the huge body of data on synapsespecific plasticity6–10, which cannot explain the spread of synaptic modulation that occurs in many neural systems11–14. Studies suggest that the intrinsic excitability of a single neuron may be regulated according to its history of firing action potentials15–17. Real and model neurons can respond actively to experimentally induced alterations in input frequency by changing expression of voltage-dependent ion channels. The mechanism underlying a neuron’s ability to calculate how these properties should be altered and what aspect of its activity is important in this calculation are not known. Brain-derived neurotrophic factor (BDNF) is proposed to be involved18, although the source of this factor (pre-, post-, auto- or non-synaptic) and the mechanism underlying its regulation of excitability are unclear. Others propose that the neuron averages over time a sequence of ‘guesses’ regarding how it should respond to given inputs16. Alternatively, a neuron may respond to signals relayed from the postsynaptic cell that indicate successful synaptic transmission. Here we report that one aspect of activity important in regulating neuronal excitability is the extent to which such activity induces synaptic transmission and subsequent retrograde signaling from activated targets. Although synaptic transmission critically depends on the shape and frequency of presynaptic action potentials, nothing is known concerning the role of synaptic activity in their regulation. Here we present evidence that presynaptic action potentials can be modulated by synaptic activation of efferent targets. Control of network properties through feedback regulation of presynaptic 142
excitability by postsynaptic cells would allow targets to modulate the responsiveness of their presynaptic neurons to afferent inputs. Such regulation could have profound implications for the function of neural networks in development and learning. Aspects of this work have previously appeared in abstract form (T.A.N. and A.B.R., Soc. Neurosci. Abstr. 25, 406.18, 1999).
RESULTS We used neuromuscular junctions (NMJs) in Xenopus neuron/myocyte co-cultures19 to investigate the role of the postsynaptic cell in the differentiation of presynaptic excitability. These cultures are essentially homogeneous during the initial differentiation of excitability, when duration of action potentials dramatically decreases20,21. However, these cultures contain a variety of neuronal subtypes22. We hypothesized that, as neurons mature in these co-cultures, they become heterogeneous with regard to electrical excitability. In addition, we proposed that synaptic activation induces myocytes to release a retrograde signal that alters motor neuron excitability. Myocytes were the ideal postsynaptic cell for this investigation because they are morphologically distinguishable from other cells and contain a variety of factors that affect motor neurons23–27. To test our hypotheses, we first compared the excitability of neurons that formed NMJs with excitability of those without NMJs. We then examined neuron excitability following blockade of synaptic activity with the nicotinic acetylcholine receptor blocker α-bungarotoxin (α-BgTx) during NMJ formation and differentiation. Neuronal properties correlate with synaptic contact We found that neurons that did not contact muscle (solitary) and those that contacted muscle but did not form an NMJ (no NMJ) were significantly different from cells that formed functional NMJs (Table 1; Figs. 1 and 2). Compared with neurons lacking NMJs (solitary, no NMJ analyzed separately), cells with NMJs had higher membrane capacitance (p < 0.0001), hyperpolarized resting potential (p < 0.0002), shorter falling phases nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
–80 mV
Control NMJ
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 1. Neurons with NMJs had shorter-duration action potentials than other neurons. Traces show sample whole-cell current-clamp recordings of motor neurons with functional NMJs (a) or myocyte contact but no NMJ (b). Action potentials had significantly shorter falling durations in neurons with NMJs compared with cells lacking NMJs. *Significantly different from control NMJ.
b Action potential falling duration (ms)
a
Control Control NMJ (29) no NMJ (28)
Control no NMJ
of the action potential (p < 0.04; Fig. 1), shorter refractory periods (compared only with no NMJ; p < 0.005; Fig. 2) and increased potassium-current (IK) density (stepped from –80 to 0 mV; p < 0.04). These findings indicate that neurons that form
NMJs fundamentally differ from cells that do not contact muscle and from those that contact muscle but do not form functional synapses. We next investigated whether these differences were due to intrinsic, cell-autonomous mechanisms of motor
Table 1. Properties of neurons vary with synaptic contact and function. Control, with NMJ 23.0 ± 0.3 n = 97
Control, no NMJ 23.2 ± 0.3 n = 85
Control, solitary 23.2 ± 0.3 n = 85
α-BgTx, NMJ 22.5 ± 0.3 n = 136
NT-3 + α-BgTx, NMJ 23.9 ± 0.4 n = 54
Membrane capacitance (pF)
64 ± 4 n = 126
30 ± 1* n = 136
25 ± 1* n = 29
50 ± 3* n = 175
47 ± 5* n = 50
Input resistance (MΩ)
723 ± 64 n = 28
836 ± 132 n = 13
689 ± 137 n=6
681 ± 61 n = 36
646 ± 75 n = 15
Resting potential (mV)
–51 ± 2 n = 96
–41 ± 2* n = 54
–31 ± 2* n = 12
–43 ± 1* n = 111
–45 ± 2* n = 36
0.65 ± 0.03 n = 28 1.64 ± 0.05 n = 30
0.60 ± 0.04 n = 27 1.52 ± 0.04 n = 28
0.54 ± 0.05 n=9 1.55 ± 0.07 n = 10
0.80 ± 0.05* n = 45 1.57 ± 0.03 n = 54
0.68 ± 0.04 n = 13 1.48 ± 0.05* n = 20
1.7 ± 0.2* n = 27 1.8 ± 0.2* n = 28
1.7 ± 0.2* n=9 1.8 ± 0.3* n = 10
1.7 ± 0.1* n = 45 2.1 ± 0.2* n = 54
1.2 ± 0.1 n = 13 1.1 ± 0.1 n = 20
58 ± 2 n = 28 102 ± 1 n = 29
58 ± 3 n = 27 103 ± 2 n = 28
49 ± 4* n=9 99 ± 2 n = 10
53 ± 2* n = 45 96 ± 1* n = 54
53 ± 2 n = 13 96 ± 2* n = 20
Refractory period (ms)
13.2 ± 1.0 n = 27
20.4 ± 2.7* n = 15
17.0 ± 2.1 n=6
17.7 ± 1.5* n = 32
12.2 ± 1.3 n = 10
Ik density at 0 mV (step from –80 mV; A/F)
89 ± 13 n = 17
50 ± 9* n = 17
51 ± 9* n = 11
59 ± 7* n = 30
109 ± 15 n = 17
Soma diameter (µm)
Mean rheobase (nA) at –40 mV at –80 mV
Action potential falling duration at –40 mV (ms) 1.2 ± 0.1 n = 28 at –80 mV (ms) 1.2 ± 0.1 n = 29 Action potential amplitude at –40 mV (mV) at –80 mV (mV)
Abbreviations: NMJ, neuromuscular junction; α-BgTx, α-bungarotoxin; NT3, neurotrophin-3. *Significantly different from control NMJ.
nature neuroscience • volume 3 no 2 • february 2000
143
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 2. Neurons with NMJs showed enhanced ability to fire repetitively. (a) Refractory period was measured with a twin-pulse protocol. Three superimposed episodes from a sample cell are shown for each condition. Dotted lines indicate the end of the second current pulse for each episode. (b) Refractory period (minimum time between two pulses that each evoke an action potential) was shorter in neurons with NMJs compared with those lacking NMJs. *Significantly different from control NMJ.
a
–40 mV
NT-3 prevents effects of synaptic blockade If synaptic blockade prevents release of a retrograde signal and subsequent differentiation of presynaptic excitability, then co-application of the putative signal to α-BgTx-treated junctions should overcome the effects of synaptic inactivity. Because this neurotrophin alters presynaptic secretion23,25,26,31 and is upregulated by myocyte depolarization31, NT-3 was the first candidate retrograde signal investigated. Co-application of NT-3 blocked effects of α-BgTx on resting potential (versus α-BgTx alone; p < 0.002) and action potential falling duration (versus α-BgTx alone; p < 0.008; Table 1; Fig. 3) but not capacitance or action potential amplitude. Thus NT-3, a potential retrograde signal released from myocytes, alters a specific subset of presynaptic electrophysiological properties.
Control no NMJ
Control NMJ
b Refractory period (ms)
Synaptic blockade alters motor neuron excitability Chronic blockade of the NMJ with rhodamine-conjugated α-BgTx changed passive (Table 1) and active (Table 1; Figs. 3–7) electrophysiological properties of motor neurons. Compared with untreated controls, motor neuron resting potential was significantly depolarized by chronic α-BgTx treatment (p < 0.0001). In addition, synaptic blockade with α-BgTx increased the duration (p < 0.006; Fig. 3) and decreased the amplitude (p < 0.003) of the action potential. Similar changes in resting potential and action potentials are observed during NMJ formation and differentiation in vivo28,29. Thus, synaptic blockade seems to prevent normal electrophysiological development of motor neurons. Capacitance of motor neurons was also decreased by α-BgTx treatment (p < 0.0001; Table 1). Decreased capacitance seemed to reflect changes in the process and/or synaptic terminal, as soma diameter was unaffected. NMJ blockade with curare modestly reduces the number of synapses formed at the earliest stages examined30. Because we examined the initial stages of NMJ formation, our results parallel these previous findings.
Control NMJ (27)
Control no NMJ (15)
The increase in action potential falling duration resulting from αBgTx-induced synaptic blockade (Fig. 3) revealed a regulatory mechanism that may explain previous reports of synaptic depression upon caged-calcium release in the myocyte14,32. During normal NMJ development without α-BgTx or with the putative retrograde signal NT3 in addition to α-BgTx, the spike substantially narrows, decreasing the amount of transmitter released per action potential. Upregulation of calcium in the myocyte increases NT-3 transcription31 and, presumably, release26,31. Thus, caged-calcium release in the myocyte may induce release of NT-3, which would tend to narrow the presynaptic action potential and seem to produce synaptic depression. Ability of motor neurons to fire repetitively increases during development33,34. Spike narrowing may allow neurons to recover from action potentials faster and thus enhance repetitive firing. Consistent with this hypothesis, we found that synaptic blockade
b
a
Action potential falling duration (ms)
© 2000 Nature America Inc. • http://neurosci.nature.com
neurons or whether signals from the postsynaptic muscle cell induce a specific set of changes in innervating neurons.
–80 mV
Control
α-BgTx
NT3 + α-BgTx
Control (29)
α-BgTx (54)
NT3 + α-BgTx (20)
Fig. 3. Chronic synaptic blockade with α-BgTx induced broadening of action potentials that was prevented with neurotrophin-3. (a) Whole-cell current-clamp recordings of motor neurons with functional NMJs following chronic α-BgTx revealed dramatic broadening of action potentials that was prevented with simultaneous application of NT-3. (b) Action potential broadening induced by α-BgTx was due to an increase in the falling duration. NT-3 prevented the α-BgTx-induced increase in falling duration (indistinguishable from controls). *Significantly different from controls. 144
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 4. Synaptic blockade reduced the ability to fire repetitively, whereas co-application of NT-3 increased repetitive-firing capacity to control levels. (a) Refractory period was measured with a twinpulse protocol. Three episodes from a sample cell are superimposed for each condition. The dotted lines indicate the end of the second current pulse for each episode. Note that action potentials overshoot the stimulus artifact in control and NT-3 + α-BgTx conditions. (b) Refractory period was increased by α-BgTx but unchanged by co-applied α-BgTx and NT-3. *Significantly different from controls.
a
10 mV 1.5 nA 5 ms
–40 mV
α-BgTx
with α-BgTx, which produces spike broadening, does indeed decrease capacity for repetitive firing as measured by an increase in refractory period (Fig. 4, p < 0.02). NT-3, which prevents α-BgTx-induced spike broadening, also prevents the increase in refractory period (versus α-BgTx; p < 0.05). These changes in repetitive firing globally regulate neuronal output. Thus, a change initiated by postsynaptic feedback at one synapse may modulate the efficacy of all synapses of a given presynaptic neuron.
Control (27)
2 nA 20 ms
α-BgTx
c
nature neuroscience • volume 3 no 2 • february 2000
K252a (10)
NGF + α-BgTx (5)
BDNF + α-BgTx (7)
NT3 + α-BgTx (17)
Voltage (mV)
α-BgTx (30)
Control (17)
NT3 + α-BgTx (17) Control (17) α-BgTx (30)
NT3 + α-BgTx (10)
NT3 + α-BgTx
Current density at 0 mV (A/F)
b
α-BgTx (32)
To further test the hypothesis that IK was modulated by neurotrophins, we exposed cultures to K252a (0.2 µM), which, at this concentration, is a relatively specific inhibitor for the neurotrophin-receptor protein-tyrosine kinases (Trks)25,35. In the absence of synaptic blockade, K252a decreased IK compared with untreated controls (p < 0.01; Fig. 5c). This further indicates the role of neurotrophins in the modulation of I K. To investigate potential non-specific neurotrophic effects of NT-3, we attempted to prevent α-BgTx effects on IK with two related neurotrophins, nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF). Neither of these factors was effective in preventing α-BgTx-induced changes in IK (NGF versus control at 0 mV, p < 0.04; BDNF, p < 0.05; Fig. 5c). Thus, NT-3 was the only neurotrophin tested that was capable of reversing the effects of synaptic blockade on IK.
a
Control
NT3 + α-BgTx
Refractory period (ms)
b
NT-3 effects on IK are specific Changes in action potential duration suggest changes in IK, which is the ionic current primarily responsible for repolarization during an action potential. We found that chronic synaptic blockade with αBgTx decreased IK density in motor neurons (measured from –20 to 0 mV; p < 0.04; Fig. 5). Moreover, NT-3 prevented this decrease in current density (versus α-BgTx, –20 to +10 mV; p < 0.007).
Current density (A/F)
© 2000 Nature America Inc. • http://neurosci.nature.com
Control
Fig. 5. Decreases in delayed-rectifier IK density induced by synaptic blockade were prevented by co-application of NT-3, but not other neurotrophins. (a) Sample whole-cell patch-clamp recordings of IK in motor neurons with NMJs revealed a substantial decrease in IK induced by chronic α-BgTx that was prevented by NT-3. (b) Current-density–voltage plots show that at several voltages α-BgTx induced a current decrease that was prevented by NT-3. (c) Although prevented by NT-3, decreases in current density induced by α-BgTx were unaffected by BDNF or NGF. K252a alone decreased current densities to levels comparable to those of motor neurons treated with α-BgTx alone. *Significantly different from controls. 145
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Synaptic blockade alters channels in a cell-wide manner To determine whether the effects of synaptic blockade extend beyond the synapse, we examined IK properties in outside-out macropatches pulled from somata. We found that, comparable
a
b
Relative tail current
Voltage (mV)
b
V1/2(mV)
The observed changes in IK density could be due to changes in the number of channels expressed, the properties of channels or both. If the number of channels in the plasma membrane changed, the maximum conductance (and, thus, maximum current density) of the neuron should also change. We found that the number of channels, as measured by maximum whole-cell tail-current density, was not significantly different across groups (control, 56 ± 6.2 A/F, n = 16; α-BgTx, 44 ± 3.9 A/F, n = 27; NT-3 + α-BgTx, 53 ± 6.4 A/F, n = 12). We next examined changes in channel properties through comparison of normalized conductance–voltage (G–V) relationships for control, α-BgTX and NT-3 + α-BgTx groups. Channel properties changed in response to α-BgTx, as indicated by a shift in the G–V curve compared with controls (measured from –20 to +10 mV; p < 0.02; Fig. 6a). Moreover, NT3 prevented this shift (versus α-BgTx, –10 to +10 mV; p < 0.05). To determine whether this shift was due to a change in the voltage that gave a half-maximal conductance (V1/2) and/or a change in the slope (k) of the G–V curve, we fit data from each neuron with the Boltzmann equation. Slope values were not significantly different (control, 15 ± 1.2 mV; α-BgTx, 13 ± 0.6 mV; NT-3 + αBgTx, 14 ± 1.2 mV). In contrast, we found that V1/2 was shifted to a more depolarized potential by α-BgTx (p < 0.0005; Fig. 6b) and that this shift was prevented by co-application of NT-3 (versus α-BgTx; p < 0.03). The finding that α-BgTx and NT-3 both affected the same IK parameters further indicates that they act upon the same pathway.
a
to whole-cell experiments, α-BgTx shifted the G–V curve in macropatches to more depolarized potentials (measured from 0 to +30 mV; p < 0.03; Fig. 7b). In these experiments, we also noted an overall depolarizing shift in both groups compared to whole-cell data, most likely due to a difference in C-type inactivation between excised membrane patches and whole-cell patches 36,37. The finding that macropatches pulled from the soma show an effect initiated at the synapse suggests that this particular postsynaptic effect on presynaptic differentiation is cell-wide. We next asked whether synaptic blockade might globally affect other ionic currents. One candidate was sodium current (I Na), as the observed decrease in action potential amplitude with α-BgTx (Table 1) suggested modulation of this current. In macropatches pulled from the soma, we found that the voltage dependence of activation of INa was shifted to more depolarized potentials in neurons after synaptic blockade with α-BgTx (measured at –10 mV: p < 0.04; Fig. 8). Whole-cell data obtained with curare blockade of the NMJ yielded similar results (T.A.N. and A.B.R., unpublished observations).
g/gmax
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 6. α-BgTx and NT-3 shifted the voltage dependence of activation of IK. (a) The relative conductance–voltage curve for motor neuron IK shifted to more depolarized values with α-BgTx-induced synaptic blockade. This shift was prevented by NT-3. (b) Boltzmann fits of G–V plots revealed a significant change in V1/2 with α-BgTx that was prevented by co-application of NT-3.
Fig. 7. G–V relation of IK shifted in response to α-BgTx in macropatches pulled from the somata of neurons as in whole-cell recordings. (a) Sample recordings of IK in macropatches pulled from motor neuron somata. (b) G–V plots of IK from control and α-BgTx-treated motor neurons. *Significantly different from controls. 146
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 8. The G–V relation of INa in macropatches pulled from the neuronal soma showed an αBgTx-induced shift. (a) Sample recordings of INa in macropatches pulled from motor neuron somata. (b) G–V plots of INa in macropatches from control and α-BgTx-treated motor neurons. *Significantly different from controls.
a
g/gmax
© 2000 Nature America Inc. • http://neurosci.nature.com
b
DISCUSSION Our data indicate that motor neuron excitability is functionally regulated by postsynaptic target cells during development. This is by no means a passive feedback circuit, as postsynaptic myocytes must be synaptically activated for modulation of excitability to occur. In contrast to well-described synapse-specific plasticity6–10, the changes in excitability we report are global. Global regulation of excitability that actively depends on feedback cues from target cells represents a mechanism whereby neural systems may self-organize and function. This mechanism would allow presynaptic neurons to modify all outputs simultaneously in response to signals from postsynaptic cells. Interestingly, the process we describe may underlie the spread of retrograde modulation of presynaptic transmission reported in the Xenopus NMJ culture system14. However, this group investigated short-term modulation, whereas we investigated long-term effects. Thus, the studies cannot be directly compared. Further examination of the temporal aspect of neurotrophin efficacy should reveal another level of complexity in the neurotrophin–excitability relationship. Although neurotrophins alter synaptic efficacy and neuronal excitability38–40, the mechanisms through which physiological control of neurotrophic effects is functionally achieved are not well understood40. Our data indicate that synaptic activity critically regulates retrograde signaling between myocyte and neuron, and that the activity-dependent retrograde signal may be a specific neurotrophin, NT-3. In the context of neuromuscular development, cell-wide changes in excitability due to postsynaptic activity may provide the soma and all synapses of the motor neuron with a measure of its success at competing in the periphery. Myocytes subject to polyneuronal innervation may differentially regulate the excitability of motor neurons based on synaptic efficacy, as previous studies suggest that retrograde signaling is localized to the site of synaptic activation32 and that presynaptic depolarization facilitates neurotrophin-induced effects41. A motor neuron that effinature neuroscience • volume 3 no 2 • february 2000
ciently stimulates a given myocyte would become more excitable and, thus, more successfully activate other contacted myocytes. This type of regulation may be particularly important during targetdependent motor neuron death, during which neurons seem to compete for limited muscle-derived factors42. Studies suggest that neurons alter their excitability in response to firing history15,16,43. A potential mechanism for this phenomenon is provided by our data, which indicate that a neuron changes its excitability based upon its recent success at synaptic output, which depends on action potentials. Cell-wide activity-dependent modulation of presynaptic excitability by postsynaptic targets would provide a feedback mechanism through which the postsynaptic cell can modulate not only a given presynaptic neuron’s responsiveness to inputs, but also its output efficiency across all synapses, thus altering output to other postsynaptic cells. This type of regulation would have important effects on neural processing. Blocking transmission at only a subset of synapses would test this hypothesis and might yield further information on potential underlying mechanisms.
METHODS Animals and cell culture. Xenopus laevis embryos were produced by standard in-vitro fertilization techniques 44 and staged according to Nieuwkoop and Faber45. Neuron/myocyte cultures were prepared as described20. The dorsal-posterior region, which contained the presumptive spinal cord and surrounding somites, was removed from neural tube stage (stage 17–19) embryos and dissociated in divalent cation-free medium (116.7 mM NaCl, 0.67 mM KCl, 0.4 mM EDTA and 4.6 mM Tris at pH 7.8). Motor neurons from these embryonic stages have never contacted muscle46. Co-cultures were plated on plastic dishes in a completely defined medium (116.7 mM NaCl, 0.67 mM KCl, 1.31 mM MgSO4, 10 mM CaCl2 and 4.6 mM Tris at pH 7.8) and recorded 15–26 h after plating. Immediately after plating, 50 ng per ml NT-3, BDNF, NGF (Alomone, Jerusalem, Israel), 0.2 µM K252a (Calbiochem, San Diego, California) and rhodaminated α-BgTx (2 µg per ml; Molecular Probes, Eugene, Oregon) were added. Cultures were thus exposed to these reagents for 15–26 h before recording. Electrophysiology. Current- and voltage-clamp records were obtained by whole-cell patch clamp47 with 1–3 MΩ electrodes. In control cultures, motor neurons with NMJs were identified by their ability to cause myocyte contraction upon stimulation with 6 voltage steps (60 ms each, in 10-mV increments from +10 to +60 mV) from a holding potential of –40 mV. Neurons that did not cause contraction were placed in the noNMJ group. Cells that did not contact muscle were placed in the solitary group. Only neurons that clearly had no contact with other neurons were used. In rhodaminated-α-BgTx-treated cultures, neurons with NMJs were identified by their ability to cause postsynaptic clustering of nicotinic acetylcholine receptors (AChRs), observed as patches of rhodamine staining under the presynaptic terminal46. Synaptic blockade was confirmed 147
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
by absence of myocyte contraction under motor neuron stimulation. To verify that differences in method of identifying motor neurons in control versus α-BgTx-treated cultures did not affect our results, we repeated experiments with the AChR blocker curare, which could be washed out, thus allowing us to identify motor neurons by ability to produce myocyte contraction. Under these conditions, results were similar to those obtained with α-BgTx (T.A.N. & A.B.R., Soc. Neurosci. Abstr. 24, 122.3, 1998). Although previous studies conflict on whether AChRs on motor neurons are α-BgTx-sensitive48,49, both studies used neurons older than those examined here. In contrast, neurons of the same age showed no acetylcholine response50. Because the motor neurons we examined did not express functional AChRs, they were probably not directly affected by α-BgTx. The pipet solution for current clamp and potassium current records contained 104 mM KCl, 3 mM MgCl2 and 10 mM HEPES at pH 7.4. For current-clamp recording, the bath solution contained 125 mM NaCl, 3 mM KCl, 10 mM CaCl2 and 5 mM HEPES at pH 7.4. Membrane potential was forced to –40 and –80 mV with injected current. Action potentials were initiated by 2-ms current injections, increased in 7 increments of 0.25 nA from 0.5 to 2.0 nA, with 5-s recovery periods between stimuli. Only action potentials that overshot the stimulus artifact by at least 2.5 mV were included in analyses. Falling duration was measured as the time from the peak of the action potential to half-peak. The minimum current that could reliably evoke action potentials with a 5-s recovery period was used in a twin-pulse examination of relative refractory period at –40 mV. The interval between the two pulses was varied from 2 to 32 ms. Relative refractory period was defined as the shortest interval between pulses that allowed an action potential in response to the second pulse. Only depolarizations that overshot the stimulus artifact by at least 2.5 mV were considered action potentials. Input resistance was determined by a 500-ms current pulse of –0.01 or –0.1 nA. Capacitance was determined from voltage-clamp recordings. The membrane potential was held at –40 mV and stepped to –90 mV in 6 steps of 10 mV. The area of the uncompensated capacitative current (charge) was plotted against voltage and fit with a linear regression. The slope of this line gave the capacitance. All data were analyzed with a two-tailed Student’s t-test and reported as mean ± standard error. Data were judged significant if p < 0.05. Numbers of observations are indicated in parentheses. For IK records, the bath solution contained 80 mM NaCl, 3 mM KCl, 5 mM MgCl2, 10 mM CoCl2 and 5 mM HEPES at pH 7.4. Tetrodotoxin (1 µM; Calbiochem) was added to block voltage-gated sodium currents. Neurons were held at –80 mV and stepped from –50 to +100 mV in 16 steps (10 mV, 60 ms) with a 5-s recovery period between steps. To minimize the possibility of inadequate space clamp, cells with capacitances above 35 pF were not used for IK analyses; this cut-off was selected because current–capacitance plots show a decline in measured current density when capacitance is ≥ 40 pF (data not shown). The α-BgTx-induced G–V shift found in whole-cell recordings was also found in macropatches, suggesting that poor control of membrane voltage in the whole-cell recordings was not responsible for the altered G–V relationship. Records were filtered at 5 kHz and sampled at 25 kHz with pClamp 6.2 (Axon, Foster City, California). For current-density measurements, mean steady-state current was measured 50–60 ms after the initiation of the voltage step. Tail current was measured 0.6 ms after the end of the pulse, which was beyond the compensated capacitative artifact for all neurons included. Relative tail current was used as a measure of whole-cell conductance because this measure obviates considerations of driving force. Calculations of conductance from steady-state current yielded similar results (data not shown). For macropatch recordings, the signal-to-noise ratio was not as high, and thus conductance was calculated from the steadystate current. Maximum tail-current density was used as a measure of channel number because the headstage of our amplifier (Axopatch 1C, Axon) was saturated by the large steady-state currents in control NMJs, and because this measure removes driving-force considerations. Inherent in the use of current density as a measure of channel number is the assumption that single-channel conductance does not change. For INa records, the bath solution contained 105 mM NaCl, 20 mM TEA-Cl, 3 mM KCl, 10 mM CoCl2 and 5 mM HEPES at pH 7.4. 148
The pipet solution contained 95 mM CsCl, 5 mM NaCl, 0.64 mM CaCl2, 2 mM EGTA and 10 mM HEPES at pH 7.4. Neurons were held at –80 mV and stepped from –40 to +40 mV in 9 steps (10 mV, 20 ms) with a 5-s recovery period between steps.
ACKNOWLEDGEMENTS We thank W. J. Betz, J. W. Karpen, J. L. Lubischer, T. C. Rich, K. R. Svoboda and B. G. Wallace for reading the manuscript; and B. Lu, T. J. Carew, L. K. Kaczmarek and M.-M. Poo for comments and suggestions. This work was supported by NIH grants to T.A.N. and A.B.R.
RECEIVED 8 SEPTEMBER; ACCEPTED 19 NOVEMBER 1999 1. Schilling, K., Dickinson, M. H., Connor, J. A. & Morgan, J. I. Electrical activity in cerebellar cultures determines Purkinje cell dendritic growth patterns. Neuron 7, 891–902 (1991). 2. Spitzer, N. C. A developmental handshake: neuronal control of ionic currents and their control of neuronal differentiation. J. Neurobiol. 22, 659–673 (1991). 3. Ruthazer, E. S. & Stryker, M. P. The role of activity in the development of long-range horizontal connections in area 17 of the ferret. J. Neurosci. 16, 7253–7269 (1996). 4. Sherrard, R. M. & Bower, A. J. Role of afferents in the development and cell survival of the vertebrate nervous system. Clin. Exp. Pharmacol. Physiol. 25, 487–495 (1998). 5. Sanes, J. R. & Lichtman, J. W. Development of the vertebrate neuromuscular junction. Annu. Rev. Neurosci. 22, 389–442 (1999). 6. Malinow, R. Transmission between pairs of hippocampal slice neurons: quantal levels, oscillations, and LTP. Science 252, 722–724 (1991). 7. Huang, Y. Y., Colino, A., Selig, D. K. & Malenka, R. C. The influence of prior synaptic activity on the induction of long-term potentiation. Science 255, 730–733 (1992). 8. Castro-Alamancos, M. A., Donoghue, J. P. & Connors, B. W. Different forms of synaptic plasticity in somatosensory and motor areas of the neocortex. J. Neurosci. 15, 5324–5333 (1995). 9. Davis, G. W. & Goodman, C. S. Synapse-specific control of synaptic efficacy at the terminals of a single neuron. Nature 392, 82–86 (1998). 10. Martin, K. C. et al. Synapse-specific, long-term facilitation of Aplysia sensory to motor synapses: a function for local protein synthesis in memory storage. Cell 91, 927–938 (1997). 11. Vincent, P. & Marty, A. Neighboring cerebellar Purkinje cells communicate via retrograde inhibition of common presynaptic interneurons. Neuron 11, 885–893 (1993). 12. Otani, S., Connor, J. A. & Levy, W. B. Long-term potentiation and evidence for novel synaptic association in CA1 stratum oriens of rat hippocampus. Learn. Mem. 2, 101–106 (1995). 13. Muller, D., Hefft, S. & Figurov, A. Heterosynaptic interactions between LTP and LTD in CA1 hippocampal slices. Neuron 14, 599–605 (1995). 14. Cash, S., Zucker, R. S. & Poo, M. M. Spread of synaptic depression mediated by presynaptic cytoplasmic signaling. Science 272, 998–1001 (1996). 15. Desai, N. S., Rutherford, L. C. & Turrigiano, G. G. Plasticity in the intrinsic excitability of cortical pyramidal neurons. Nat. Neurosci. 2, 515–520 (1999). 16. Stemmler, M. & Koch, C. How voltage-dependent conductances can adapt to maximize the information encoded by neuronal firing rate. Nat. Neurosci. 2, 521–527 (1999). 17. Spitzer, N. C. New dimensions of neuronal plasticity. Nat. Neurosci. 2, 489–491 (1999). 18. Desai, N. S., Rutherford, L. C. & Turrigiano, G. G. BDNF regulates the intrinsic excitability of cortical neurons. Learn. Mem. 6, 284–291 (1999). 19. Henderson, L. P., Smith, M. A. & Spitzer, N. C. The absence of calcium blocks impulse-evoked release of acetylcholine but not de novo formation of functional neuromuscular synaptic contacts in culture. J. Neurosci. 4, 3140–3150 (1984). 20. Spitzer, N. C. & Lamborghini, J. E. The development of the action potential mechanism of amphibian neurons isolated in culture. Proc. Natl. Acad. Sci. USA 73, 1641–1645 (1976). 21. Henderson, L. P. & Spitzer, N. C. Autonomous early differentiation of neurons and muscle cells in single cell cultures. Dev. Biol. 113, 381–387 (1986). 22. Bixby, J. L. & Spitzer, N. C. The appearance and development of neurotransmitter sensitivity in Xenopus embryonic spinal neurones in vitro. J. Physiol. (Lond.) 353, 143–155 (1984). 23. Lohof, A. M., Ip, N. Y. & Poo, M.-M. Potentiation of developing neuromuscular synapses by the neurotrophins NT-3 and BDNF. Nature 363, 350–353 (1993). 24. Stoop, R. & Poo, M.-M. Potentiation of transmitter release by ciliary neurotrophic factor requires somatic signaling. Science 267, 695–699 (1995). 25. Wang, T., Xie, K. & Lu, B. Neurotrophins promote maturation of developing neuromuscular synapses. J. Neurosci. 15, 4796–4805 (1995).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
26. Liou, J.-C. & Fu, W.-M. Regulation of quantal secretion from developing motoneurons by postsynaptic activity-dependent release of NT-3. J. Neurosci. 17, 2459–2468 (1997). 27. Wang, X. H. & Poo, M. M. Potentiation of developing synapses by postsynaptic release of neurotrophin-4. Neuron 19, 825–835 (1997). 28. Kellerth, J. O., Mellstrom, A. & Skoglund, S. Postnatal excitability changes of kitten motoneurones. Acta Physiol. Scand. 83, 31–41 (1971). 29. Ziskind-Conhaim, L. Electrical properties of motoneurons in the spinal cord of rat embryos. Dev. Biol. 128, 21–29 (1988). 30. Dahm, L. M. & Landmesser, L. T. The regulation of synaptogenesis during normal development and following activity blockade. J. Neurosci. 11, 238–255 (1991). 31. Xie, K., Wang, T., Olafsson, P., Mizuno, K. & Lu, B. Activity-dependent expression of NT-3 in muscle cells in culture: implications in the development of neuromuscular junctions. J. Neurosci. 17, 2947–2958 (1997). 32. Cash, S., Dan, Y., Poo, M.-M. & Zucker, R. Postsynaptic elevation of calcium induces persistent depression of developing neuromuscular synapses. Neuron 16, 745–754 (1996). 33. Fulton, B. P. & Walton, K. Electrophysiological properties of neonatal rat motoneurones studied in vitro. J. Physiol. (Lond.) 370, 651–678 (1986). 34. Xie, H. & Ziskind-Conhaim, L. Blocking Ca2+-dependent synaptic release delays motoneuron differentiation in the rat spinal cord. J. Neurosci. 15, 5900–5911 (1995). 35. Berg, M. M., Sternberg, D. W., Parada, L. F. & Chao, M. V. K-252a inhibits nerve growth factor-induced trk proto-oncogene tyrosine phosphorylation and kinase activity. J. Biol. Chem. 267, 13–16 (1992). 36. Marom, S., Goldstein, S. A., Kupper, J. & Levitan, I. B. Mechanism and modulation of inactivation of the Kv3 potassium channel. Receptors Channels 1, 81–88 (1993). 37. Kupper, J., Bowlby, M. R., Marom, S. & Levitan, I. B. Intracellular and extracellular amino acids that influence C-type inactivation and its modulation in a voltage-dependent potassium channel. Pflugers Arch. 430, 1–11 (1995).
nature neuroscience • volume 3 no 2 • february 2000
38. Lesser, S. S., Sherwood, N. T. & Lo, D. C. Neurotrophins differentially regulate voltage-gated ion channels. Mol. Cell. Neurosci. 10, 173–183 (1997). 39. Sherwood, N. T., Lesser, S. S. & Lo, D. C. Neurotrophin regulation of ionic currents and cell size depends on cell context. Proc. Natl. Acad. Sci. USA 94, 5917–5922 (1997). 40. McAllister, A. K., Katz, L. C. & Lo, D. C. Neurotrophins and synaptic plasticity. Annu. Rev. Neurosci. 22, 295–318 (1999). 41. Boulanger, L. & Poo, M.-M. Presynaptic depolarization facilitates neurotrophin-induced synaptic potentiation. Nat. Neurosci. 2, 346–351 (1999). 42. Purves, D. & Lichtman, J. W. in Principles of Neural Development 131–154 (Sinauer, Sunderland, Massachusetts, 1985). 43. Golowasch, J., Abbott, L. F. & Marder, E. Activity-dependent regulation of potassium currents in an identified neuron of the stomatogastric ganglion of the crab Cancer borealis. J. Neurosci. 19, RC33 (1999). 44. Tabti, N. & Poo, M.-M. in Culturing Nerve Cells (eds. Banker, G. & Goslin, K.) 137–154 (MIT Press, Cambridge, Massachusetts, 1991). 45. Nieuwkoop, P. D. & Faber, J. Normal Table of Xenopus laevis (Daudin, Amsterdam, 1967). 46. Kullberg, R. W., Lentz, T. L. & Cohen, M. W. Development of the myotomal neuromuscular junction in Xenopus laevis: an electrophysiological and finestructural study. Dev. Biol. 60, 101–129 (1977). 47. Hamill, O. P., Marty, A., Neher, E., Sakmann, B. & Sigworth, F. J. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 391, 85–100 (1981). 48. Perrins, R. & Roberts, A. Nicotinic and muscarinic ACh receptors in rhythmically active spinal neurones in the Xenopus laevis embryo. J. Physiol. (Lond.) 478, 221–228 (1994). 49. Fu, W. M., Liou, H. C. & Chen, Y. H. Nerve terminal currents induced by autoreception of acetylcholine release. J. Neurosci. 18, 9954–9961 (1998). 50. Bixby, J. L. & Spitzer, N. C. The appearance and development of chemosensitivity in Rohon-Beard neurones of the Xenopus spinal cord. J. Physiol. (Lond.) 330, 513–536 (1982).
149
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
A new form of long-term depression in the perirhinal cortex K. Cho1, N. Kemp1, J. Noel1,2, J. P. Aggleton3, M. W. Brown1 and Z. I. Bashir1 1
MRC Centre for Synaptic Plasticity, Dept. of Anatomy, University of Bristol, Bristol BS8 1TD, UK
2
Present address: Biologie cellulaire des compartiments calciques, Universite de Nice-Sophia Antipolis, Faculte des sciences, 06108 Nice, France
3
School of Psychology, Cardiff University, Cardiff CF10 3YJ, UK
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to Z.I.B. (
[email protected])
We demonstrate a form of long-term depression (LTD) in the perirhinal cortex that relies on interaction between different glutamate receptors. Group II metabotropic glutamate (mGlu) receptors facilitated group I mGlu receptor-mediated increases in intracellular calcium. This facilitation plus NMDA receptor activation may be necessary for induction of LTD at resting membrane potentials. However, depolarization enhanced NMDA receptor function and removed the requirement of synergy between group I and group II mGlu receptors: under these conditions, activation of only NMDA and group I mGlu receptors was required for LTD. Such glutamate receptor interactions potentially provide new rules for synaptic plasticity. These forms of LTD occur in the perirhinal cortex, where long-term decreases in neuronal responsiveness may mediate recognition memory.
There are good reasons for believing that decreases in synaptic efficacy in neurons of the perirhinal cortex, the region of temporal cortex adjacent to the rhinal sulcus, are related to recognition memory1. Lesions of perirhinal cortex in rats and primates impair performance of recognition-memory tasks2–4. Importantly, perirhinal neuronal responses to novel visual stimuli decrease markedly once such stimuli become familiar1,5,6. The decrement in responsiveness can last many hours, and this change may provide the information required to solve such tasks. Activity-dependent long-term depression of synaptic transmission in perirhinal cortex provides a potential mechanism for explaining decreases in neuronal responsiveness. Induction of homosynaptic LTD depends on postsynaptic increases in calcium7–9 brought about by different mechanisms that include activation of NMDA receptors10–12 or mGlu receptors13–17. However, there is no evidence for a role of mGlu receptor activation under conditions in which NMDA receptor activation underlies the induction of activity-dependent LTD. Furthermore, there seems to be no role for NMDA receptor activation when mGlu receptors are involved in the induction of activity-dependent LTD. Group I mGlu receptors and NMDA receptors cause distinct forms of LTD by coupling to the activation of protein kinase C and protein phosphatases, respectively14–16,18. An alternative potential means of LTD induction by group I mGlu receptor activation is through phosphoinositideinduced release of calcium from intracellular stores19–22. A presynaptic role for group II mGlu receptors in LTD at mossy fiber synapses23,24 seems to depend on cAMP turnover25, but the mechanisms underlying the role of group II mGlu receptors in other regions are not well understood26–28. Perirhinal cortex is critically involved in a number of different types of memory. NMDA receptor-dependent LTP29,30 can be induced in perirhinal cortex in vitro; in addition, investigating mechanisms of LTD may provide insights into fundamental mechanisms of learning and memory in this and other regions 150
of cortex. Here we describe conditions for the induction of activity-dependent LTD in adult perirhinal cortex. We demonstrate a new form of LTD in this cortex that relies on the activation of NMDA and group I and group II mGlu receptors.
RESULTS In the perirhinal cortex, stimulation delivered to either side of the rhinal sulcus in layers II/III resulted in synaptic transmission that was dependent on AMPA/kainate and NMDA receptors30 (Fig. 1). Low-frequency stimulation (LFS; 200 stimuli, 1 Hz) delivered to either the entorhinal or the temporal side of the rhinal sulcus combined with depolarization of the postsynaptic neuron to –40 mV induced robust homosynaptic LTD measured 30–35 minutes after stimulation. No differences were found between the magnitude of LTD with stimulation to the entorhinal or the temporal cortex side (p > 0.05); therefore, data from the two inputs were pooled (mean depression of 47 ± 8%, n = 10; Fig. 2a) in this and subsequent experiments. Voltage clamp of neurons at –40 mV for 200 s without LFS did not result in LTD (+1 ± 8%; n = 8, p > 0.05; data not shown). LTD was also induced by LFS delivered while the postsynaptic cell was voltage clamped at –70 mV (depression of 37 ± 8%, n = 8; Fig. 2b). LTD induced by either of the above protocols was maintained for as long as the recording was continued (up to 180 min; data not shown). The NMDA receptor antagonist AP5 (50 µM) blocked the induction of LTD measured 30–35 min after LFS delivered at –40 mV (2 ± 5%, n = 7, p > 0.05; Fig. 2c). In three experiments, AP5 was washed out, and subsequent LFS resulted in LTD (52 ± 11%, n = 3, p < 0.05; Fig. 2c). In a separate series of experiments, AP5 blocked LTD at –70 mV (1 ± 5%, n = 7; p > 0.05; Fig. 2d) in a reversible manner (48 ± 9%, p < 0.05, n = 3; Fig. 2d). In keeping with the voltage dependence of NMDA receptor-mediated synaptic transmission, LTD was prevented by hyperpolarizing neurons to –90 mV (7 ± 6%, n = 3, not shown) or –110 mV (3 ± 11%, n = 3, not shown). To determine if a postsynaptic rise nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
© 2000 Nature America Inc. • http://neurosci.nature.com
b
c
Fig. 1. The perirhinal cortex. (a) Lateral view of the rat brain (from ref. 44) indicating the position of the perirhinal cortex (areas 35 and 36) to either side of the rhinal sulcus. Approximate angles of in vitro slices are illustrated by diagonal lines. (b) Representation of the perirhinal cortex slice indicating electrode positions. Whole-cell recordings (Rec) were obtained from single neurons in layer II/III. Stimulating electrodes (S1 and S2) were positioned in layer II/III either side (temporal and entorhinal) of the recording electrode. (c) Synaptic EPSCs in perirhinal cortex neurons voltage clamped at –70 mV rely on activation of AMPA/kainate and NMDA receptors, as demonstrated by the effects of NBQX and AP5 (ref. 30).
in calcium was necessary for LTD, we used whole-cell filling solution containing 10 mM EGTA. Under these recording conditions, induction of LTD was prevented when LFS was delivered at either –40 or –70 mV (Fig. 2e and f). To determine if metabotropic glutamate (mGlu) receptors have a role in LTD, we used the broad-spectrum (group I/II) mGlu receptor antagonist MCPG31,32. MCPG (500 µM) prevented the induction of LTD when LFS was delivered at –40 mV (Fig. 3a; 1 ± 6%, n = 7, p > 0.05). Following MCPG washout in 3 experiments, LFS resulted in LTD (47 ± 7%, n = 3, p < 0.05; Fig. 3a). MCPG also blocked induction of LTD at –70 mV (Fig. 3b; 1 ± 9%, n = 7, p > 0.05) in a reversible manner (46 ± 6%, n = 3, p < 0.05; Fig. 3b). The group I mGlu receptor antagonist AIDA33,34 blocked LTD at –40 mV (Fig. 3c; +1 ± 7%, n = 7, p > 0.05) in a reversible manner (35 ± 7%, n = 3, p < 0.05). At –70 mV, AIDA also produced a block of LTD induction (Fig. 3d; 1 ± 11%, n = 6, p > 0.05) that was reversible (35 ± 10%, n = 2). MAP4, a group III mGlu receptor antagonist35, failed to prevent LTD at either –40 or –70 mV (43 ± 11%, and 41 ± 10%, respectively, n = 4, p < 0.05 for each; Fig. 3e and f). These results suggest that both group I mGlu receptors and NMDA receptors are nature neuroscience • volume 3 no 2 • february 2000
required for the induction of LTD. This result was unexpected because in previously reported cases of activity-dependent LTD, induction relies on either NMDA or mGlu receptors but not on activation of both. The activation of group II metabotropic glutamate (mGlu) receptors by application of DCG-IV can result in a long-lasting depression of field EPSPs in perirhinal cortex36. We investigated whether synaptic activation of group II mGlu receptors has a role in LTD. The group II mGlu receptor antagonist EGLU37 did not block the induction of LTD when LFS was delivered at –40 mV (depression of 40 ± 9%, n = 4; p < 0.01, Fig. 4a). Surprisingly, however, EGLU blocked LTD when LFS was delivered at –70 mV (depression of 3 ± 7%, n = 7; p > 0.05; Fig. 4b). In 3 experiments, EGLU was washed out, and subsequent LFS induced LTD (46 ± 12%, n = 3, p < 0.05; Fig. 4b). LTD was also blocked by the group II/III mGlu receptor antagonist CPPG (200 µM) when LFS was delivered at –70 mV (2 ± 10% in CPPG and 47 ± 14% following washout; n = 3; data not shown). Because the role of group II mGlu receptors in LTD depended on membrane potential, we investigated whether group II mGlu receptors were involved in LTD under protocols in which the membrane potential was not voltage clamped, thus more closely approximating conditions in vivo. LFS was delivered while the postsynaptic neuron was held in current clamp at –70 mV, a value close to normal resting potential. With the membrane potential free to change during LFS, LTD was still reliably induced (depression of 39 ± 7%, n = 3; p < 0.05, Fig. 4c). Interestingly, under these conditions LTD still depended on the activation of group II mGlu receptors, as LTD was blocked by EGLU (3 ± 14%, n = 3; p > 0.05, Fig. 4d). The voltage dependence of involvement of group II mGlu receptors in LTD was unexpected. We reasoned that group II mGlu receptors might be important during decreased NMDA receptor activation. Therefore, their involvement might relate to voltage dependence of NMDA receptor activation, and not to a voltage dependence of group II mGlu receptors per se. If this were the case, increasing NMDA receptor activation and calcium influx at –70 mV should remove the requirement for group II mGlu receptors in LTD induction. In keeping with this suggestion, when extracellular calcium was increased (from 2 to 4 mM), LTD induced at –70 mV was not blocked by EGLU (63 ± 7%, n = 3; p < 0.01, Fig. 5a). When extracellular magnesium was reduced (from 1 to 0.01 mM) to enhance NMDA receptor function, LTD induced at –70 mV was not blocked by EGLU (41 ± 9% depression, n = 3; p < 0.01, Fig. 5b). Thus enhancing NMDA receptor activation removes group II mGlu receptor involvement in LTD. Conversely, decreasing NMDA receptor activation at –40 mV might produce a requirement for group II mGlu receptor activation in LTD at depolarized membrane potentials. In a low concentration of AP5 (2 µM), LTD was induced by pairing LFS with depolarization of the postsynaptic neuron to –40 mV. LTD induced at –40 mV under these conditions was blocked by EGLU (+6 ± 10%, measured 10 min after LFS; n = 3; p > 0.05, Fig. 5c and d). These results suggest that the levels of NMDA receptor activation determine the requirement of group II mGlu receptors in LTD. One explanation for these results is that cooperativity between group I and II mGlu receptors and NMDA receptors may be required to increase calcium levels for induction of LTD at resting membrane potentials. Because LTD is blocked during antagonism of either NMDA or group I mGlu receptors and because group II mGlu receptors do not directly couple to calcium signaling, it is possible that group II mGlu receptors interact with 151
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a Normalized peak EPSC (% of baseline)
b
Time (min)
Time (min)
Normalized peak EPSC (% of baseline)
d
Time (min)
e
Time (min)
f
Normalized peak EPSC (% of baseline)
© 2000 Nature America Inc. • http://neurosci.nature.com
c
Time (min)
NMDA or group I mGlu receptors. We demonstrated a synergistic interaction between group II and group I mGlu receptors (Fig. 6). At –70 mV, the inward current produced by the group I mGlu receptor agonist DHPG37 was significantly (p < 0.05) increased by the group II mGlu receptor agonist DCG-IV (Fig. 6a; 15 ± 6 without DCG-IV; 59 ± 17 pA with DCG-IV, n = 4). Because DCG-IV acts as an agonist at NMDA receptors38 (albeit at higher concentrations than 0.5 µM), these experiments were carried out in the presence of 50 µM AP5. In control experiments without DCG-IV, a second application of DHPG produced inward currents of similar magnitudes to that produced by a first application of DHPG (data not shown). To investigate how interaction between group I and group II mGlu receptors might facilitate LTD, we monitored intracellular calcium levels. In cultured perirhinal cortex neurons, DHPG (20 µM) increased fluorescence of Fluo-3-AM filled neurons (21 ± 6% increase; n = 16 neurons). This was significantly (p < 0.05) enhanced (45 ± 10%; n = 16, Fig. 6b and d) by co-application of DHPG with the group II mGlu receptor agonist DCG-IV (1 µM). DCG-IV itself had no effect on fluorescence levels 152
Fig. 2. LTD relies on activation of NMDA receptors and a postsynaptic increase in calcium. (a) LFS paired with depolarization to –40 mV results in LTD in the input receiving LFS but not in the control input (not shown). (b) Delivering LFS with the neuron voltage clamped at –70 mV also results in homosynaptic LTD, with no effect on the control input (not shown). (c) LTD is blocked by the NMDA receptor antagonist AP5 when LFS is paired with depolarization to –40 mV. LFS following AP5 washout in three of these experiments induced LTD. (d) LTD was blocked by AP5 when LFS was delivered at –70 mV. In three experiments, LFS induced LTD after AP5 was washed out. (e, f) The calcium chelator EGTA (10 mM) blocks the induction of LTD 20–25 min after LFS at both –40 mV (e) and –70 mV (f). The control concentration of EGTA (0.5 mM) had no effect on LTD in interleaved control experiments (not shown). Illustrated synaptic responses are taken from appropriate time points, as indicated (1, 2). The control and depressed responses (and voltage steps; –5 mV) are also shown superimposed (1, 2). The period of LFS (200 stimuli, 1 Hz) is indicated by the horizontal bar joined by the two arrows. In this and subsequent figures, filled circles indicate experiments in which the neuron was depolarized to –40 mV only for the duration of LFS. Open circles indicate experiments in which LFS was delivered while the neuron was voltage clamped at –70 mV. Breaks in the x axes (c, d) indicate the time at which AP5 was washed out.
Time (min)
(Fig. 6c). In separate experiments (Fig. 6c and e), the enhancement by DCG-IV of DHPG-induced calcium mobilization (44 ± 7%; n = 23 neurons) was reversibly blocked by the group II mGlu receptor antagonist EGLU (15 ± 4%; n = 23 neurons). Therefore, group II and group I mGlu receptors can interact to increase intracellular calcium levels in neurons of the perirhinal cortex. We postulate that this synergistic increase in calcium may underlie the observed induction of LTD at resting membrane potentials.
DISCUSSION This study describes an activity-dependent LTD in the adult perirhinal cortex. This finding is significant because this LTD may reflect mechanisms underlying recognition memory-related decreases in neuronal responses in perirhinal cortex in vivo1,5,6. The mechanisms of homosynaptic activity-dependent LTD in the perirhinal cortex are notable because these depend on synaptic activation of both NMDA receptors and mGlu receptors, in marked contrast to previously described forms of activity-dependent LTD that depend either on the activation of NMDA recepnature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
b
Normalized peak EPSC (% of baseline)
a
Time (min)
Normalized peak EPSC (% of baseline)
d
Time (min)
e
f
Normalized peak EPSC (% of baseline)
© 2000 Nature America Inc. • http://neurosci.nature.com
c
Time (min)
Time (min)
tors10–12 or on the activation of mGlu receptors13,14,16,17, but not on the conjoint activation of both. Indeed, distinct NMDA and mGlu receptor-dependent forms of LTD coexist in the CA1 region of the hippocampus15. Although we have not investigated biochemical mechanisms of perirhinal LTD, NMDA receptor-dependent LTD relies on protein phosphatase activation18, whereas mGlu receptor-dependent LTD depends on protein kinase C activation14,16 in the hippocampus. The conjoint activation of NMDA and mGlu receptors provides an additional rule for the induction of synaptic plasticity. The cerebral cortex can potentially exploit the variety of such rules, either to effect different types of memory or to increase the conditions for memory storage. The most intriguing finding is that Group II mGlu receptors are involved in LTD at resting membrane potentials but not at depolarized potentials. Our results indicate that the role for group II mGlu receptors depends on the level of NMDA receptor activation, rather than membrane potential per se. We propose that at depolarized potentials, when NMDA receptor activation is increased, co-activation of NMDA and group I mGlu receptors is sufficient and necessary to trigger the induction of LTD. Hownature neuroscience • volume 3 no 2 • february 2000
Fig. 3. LTD depends on group I but not group III mGlu receptor activation. (a) LTD is blocked by the mGlu receptor antagonist MCPG when LFS is delivered at –40 mV. In three experiments, MCPG was washed out, and LTD was subsequently induced. (b) LTD was blocked by MCPG at –70 mV; in 3 experiments, LFS resulted in LTD following washout. (c) The group I mGlu receptor antagonist AIDA prevented the induction of LTD at –40 mV; in three experiments, LFS after AIDA washout resulted in LTD. (d) LTD was blocked by AIDA at –70 mV. In two experiments, AIDA was washed out and LTD subsequently induced by LFS. (e, f) LTD was not blocked by MAP4 either at –40 mV (e) or at –70 mV (f).
ever, at resting membrane potentials, when calcium influx through NMDA receptor channels is restricted, the additional activation of group I mGlu Time (min) receptors is insufficient for LTD. Under these conditions, induction of LTD requires activation of group II mGlu receptors. It is not known if this mechanism confers unique properties on perirhinal cortical plasticity or if it also occurs in widespread cortical regions. Thus, although group II mGlu receptors have a role in LTD in other brain regions26–28, it is not known if this also occurs at resting membrane potentials, as reported here. Although activation of postsynaptic group II Time (min) mGlu receptors probably explains our results, the possibility that presynaptic group II mGlu receptors also have some role in LTD cannot be ruled out23,24. It is interesting to note that the mGlu receptor antagonists MCPG and EGLU reduced the depression of transmission during LFS, an effect more evident when LFS was delivered at –70 mV. This suggests that synaptic activation of mGlu receptors may transiently decrease synaptic transmission, possibly via a presynaptic mechanism, as has been demonstrated at mossy fiber synapses39. At –40 mV, the decreased driving force also results in EPSP depression, making it difficult to determine the effects of mGlu receptor antagonists on depression during LFS. Group II mGlu receptors are located both pre- and postsynaptically and are known to decrease forskolin-stimulated cAMP turnover23,24. However, we provide evidence that the activation of group II mGlu receptors can increase group I mGlu receptormediated calcium mobilization. This result extends previous work40,41 showing that group II mGlu receptors increase group I mGlu receptor-dependent phosphoinositide turnover. The precise mechanisms underlying the synergy between these groups of mGlu receptors remain to be identified. However, this inter153
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
b
Normalized peak EPSC (% of baseline)
a
Normalized peak EPSC (% of baseline)
c
Time (min)
a
Time (min)
current clamp
Time (min)
Therefore, these results suggest a mechanism for the requirement of synaptic activation of group II mGlu receptors in LTD. Our results demonstrate that LTD in the perirhinal cortex can depend on several different types of glutamate receptor, thus raising the question as to the physiological relevance of various mech-
c Normalized peak EPSC (% of baseline)
Normalized peak EPSC (% of baseline)
Time (min)
d
Time (min)
Normalized peak EPSC (% of baseline)
b
d
current clamp
action may occur directly between Gβγ subunits (activated by group II mGlu receptors) and Gq/11α (activated by group I mGlu receptors)40 rather Time (min) than involve group II mGlu receptor-mediated changes in cAMP turnover41. Whatever the underlying mechanism, our results demonstrate that this interaction increases intracellular calcium. Given the essential role of calcium in the induction of synaptic plasticity, this synergy may be required for LTD in the perirhinal cortex at resting membrane potentials.
Normalized peak EPSC (% of baseline)
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 4. The role of group II mGlu receptors in LTD is voltage dependent. (a) The group II mGlu receptor antagonist EGLU did not block the induction of LTD when LFS was delivered at –40 mV. (b) However, when LFS was delivered at –70 mV, LTD was blocked by EGLU but could be induced in three experiments following washout. (c) Delivering LFS to the neuron in current clamp (at –70 mV) results in LTD induction that is also blocked by the group II mGlu receptor antagonist EGLU (d).
Time (min)
Time (min)
Fig. 5. The role of group II mGlu receptors in LTD is influenced by the level of NMDA receptor activation. (a, b) EGLU does not block LTD at –70 mV in 4 mM extracellular Ca2+ (a) or in 0.01 mM extracellular Mg2+ (b). (c, d) Single example (c) and pooled data (d) show that EGLU prevents the induction of LTD at –40 mV when NMDA receptor activation is decreased by 2 µM AP5. Induction of LTD was not blocked by this concentration of AP5 alone (c). 154
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Change in holding current (pA)
Time (min)
c
d
Fluorescence (% of baseline)
Fluorescence ( % of baseline)
b
Time (s)
e
Time (s)
Fluorescence (% of baseline)
anisms. One possibility is that the decreased neuronal activity with stimulus repetition in perirhinal cortex1 arises from a variety of afferent-activation patterns appropriately encoded by the various synaptic and molecular mechanisms we identified. It is also possible that the different mechanisms underlying synaptic plasticity are necessary for the variety of forms of learning and memory involving neurons in perirhinal cortex1–4. In conclusion, the results of this study identify new mechanisms of activity-dependent synaptic plasticity that rely on a functional interaction between different classes of synaptically activated glutamate receptors.
a
Fluorescence (% of baseline)
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 6. Group II mGlu receptor activation by DCG-IV enhances group I mGlu receptor (DHPG)-induced inward current and calcium mobilization. (a) DHPG induced an inward current that was significantly enhanced by DCG-IV. To prevent any agonist effect of DCG-IV at NMDA receptors, we used a low concentration of DCG-IV (0.5 µM) in the presence of 50 µM AP5. (b) Single example of fluorescence increase in a cultured perirhinal cortex neuron in response to application of 20 µM DHPG. The calcium rise in response to DHPG is synergistically increased in a reversible manner by the coapplication of DCG-IV. (c) Single example illustrates reversible block by EGLU of DCG-IV’s enhancement of DHPG-induced fluorescence increase. (d) Pooled data illustrate that DHPGinduced calcium mobilization was significantly enhanced by DCG-IV. (e) Pooled data show that DCG-IV’s enhancement of the DHPG response is blocked by EGLU. Neither EGLU nor DCG-IV alone had any effect on fluorescence.
METHODS Electrophysiology. Slices of perirhinal cortex were prepared from adult male DA rats (150–270 g, 7–12 weeks, Bantin and Kingman, UK). All efforts were made to minimize numbers of animals used. Animals were anesthetized with halothane, decapitated in accordance with the UK Animals (Scientific Procedures) Act 1986, the brain rapidly removed and placed in ice-cold artificial cerebrospinal fluid (aCSF; bubbled with 95% 02/5% CO2), which comprised 124 mM NaCl, 3 mM KCl, 26 mM NaHCO3, 1.25 mM NaH2PO4, 2 mM CaCl2, 1 mM MgSO4 and 10 mM D-glucose. A midsagittal section of the brain was made, the rostral and caudal parts were removed by single scalpel cuts approximately 45° to the dorsoventral axis, and each half was glued by its caudal end to a vibroslice stage (Campden Instruments, Sileby, UK). Slices (400 µm) that included perirhinal, entorhinal and temporal cortices were stored submerged in aCSF (20–25°C). A single slice was placed in a submerged recording chamber (28–30°C; flow rate, ∼2 ml per min) when required. Picrotoxin (5 µM) was present throughout the experiment. Blind whole-cell recordings were obtained from neurons in layer II/III. Pipet (4–7 MΩ) solutions (280 mOsm, pH 7.2) comprised 130 mM cesium methyl sulfate, 8 mM NaCl, 4 mM Mg-ATP, 0.3 mM Na-GTP, 0.5 mM EGTA, 10 mM HEPES and 6 mM QX-314. In some experiments, potassium methyl sulfate was substituted for cesium methyl sulfate, and QX-314 was omitted. High-EGTA filling solution contained 10 mM EGTA, substituted for equimolar cesium methyl sulfate to maintain osmolarity. One stimulating electrode was placed dorsorostrally on the temporal cortex side (area 36) and one ventrocaudally on the entorhinal cortex side (area 35/entorhinal cortex) of the rhinal sulcus. Stimuli (constant voltage) were delivered alternately to the two electrodes (each electrode 0.033 Hz). Neurons were voltage clamped at –70 mV unless otherwise indicated. To induce LTD in each slice, lowfrequency stimulation (LFS; 200 stimuli, 1 Hz) was delivered to only one input. LFS was delivered at –70 mV, paired with depolarization to –40 mV or delivered under current clamp at –70 mV, as appropriate for different experiments. Alterations of membrane potential were made only during the LFS. Amplitudes of the evoked EPSCs were measured and nature neuroscience • volume 3 no 2 • february 2000
expressed relative to the normalized pre-conditioning baseline. Effects of LFS were measured at appropriate time points (averaged over five min) after delivering LFS. Data were analyzed from only one slice per rat unless otherwise indicated. Data pooled across slices are expressed as means ± s.e. and significance (p < 0.05) tested using either paired or unpaired t-tests as appropriate. Only experiments in which there was little baseline drift (<10%) were included in the pooled data. Data were recorded using an Axopatch 200 amplifier (Axon Instruments, Foster City, California), monitored and analyzed on line and re-analyzed off line (W.W. Anderson, G. L. Collingridge, Soc. Neurosci. Abstr. 23, 665, 1997). Agonists and antagonists were applied by addition to the perfusate. Cell culture. Perirhinal cultures were prepared according to described methods42 for preparation of hippocampal cultures. Briefly, the perirhinal cortex was removed from rats (three to five days old) and neurons recovered by enzymatic digestion and mechanical dissociation. Cells were plated onto coverslips in 35-mm petri dishes. Cultures were maintained at 37°C in a 95% O2/5% CO2-humidified incubator. The culture media was composed of minimal essential media (Gibco; 30 mM glucose, 2 mM glutamine; 15 mM HEPES, 100 µg per ml bovine transferrin and 30 µg per ml insulin, complemented with 5–10% fetal calf serum). From the second day in culture, the media were supplemented with cytosine-β-Darabinofuranoside (2.5 µM). Neurons were used for calcium-imaging studies 14–30 days after plating. Calcium imaging. Imaging techniques were used as described previously32,43. Briefly, cells were washed three times in HBS buffer (119 mM NaCl, 5 mM KCl, 25 mM HEPES, 33 mM glucose, 2 mM CaCl2, 2 mM MgCl2, 500 nM TTX, 1 µM glycine, 100 µM picrotoxin, pH 7.4; osmolarity, 155
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
300–310 mOsm) and loaded with 5 µM of the membrane-permeable Ca2+ indicator fluo-3-AM made up in 1 mg per ml bovine serum albumin/HBS at 37°C for 20 min. Cells were then washed 3 times in HBS and incubated for 30 min in a 5% CO2 atmosphere at 22°C to allow for the de-esterification of the flurophore. Cells were then viewed on a BioRad (Hemel Hempstead, UK) MRC600 confocal microscope equipped with an argon ion laser using standard green filter sets and perfused continuously at ∼2 ml per min with HBS buffer to which AP5 (50 µM) was added. Agonists were bath applied. Integrations of five individual images were obtained every 10 s before, during and after agonist application. In six of seven cover slips used in this study, DHPG-induced fluorescence was significantly enhanced by DCGIV. All neurons from these six cover slips that initially responded to DHPG with an increase in fluorescence were used in subsequent analysis. The fluorescence of individual cells in each preparation was measured using a public-domain NIH program (http://rsb.info.nih.gov/nihimage/) and expressed relative to baseline. The mean peak fluorescence was then calculated. Drugs (all from Tocris, Bristol, UK) used were the N-methyl-D-aspartate (NMDA) receptor antagonist D-2-amino-5-phosphonopentanoate (AP5), the metabotropic glutamate (mGlu) receptor antagonists (S)-αmethyl-4-carboxyphenylglycine (MCPG) (R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA) (S)-2-amino-2-methyl-4-phosphonobutanoic acid (MAP4) and (2S)-α-ethylglutamic acid (EGLU) and the mGlu receptor agonists (R,S)-3,5-dihydroxyphenylglycine (DHPG) and (2S,2′R,3′R)2-(2′,3′-dicarboxycyclopropyl)glycine (DCG-IV).
ACKNOWLEDGEMENTS We thank A. Doherty, L. Pickard and V. Collett for help with cell culture and calcium imaging and G.L. Collingridge for discussions. This work was supported by the BBSRC, MRC and Wellcome Trust.
RECEIVED 29 OCTOBER, ACCEPTED 23 NOVEMBER 1999 1. Brown, M. W. & Xiang, J.-Z. Recognition memory: neuronal substrates of the judgement of prior occurrence. Prog. Neurobiol. 55, 149–189 (1998). 2. Meunier, M., Bachevalier, J., Mishkin, M. & Murray, B. Effects on visual recognition of combined and separate ablations of the entorhinal and perirhinal cortex in rhesus monkeys J. Neurosci. 13, 5418–5432 (1993). 3. Sakai, K. & Miyashita, Y. Neural organization for the long-term memory of paired associates. Nature 354, 152–155 (1999). 4. Corodimas, K. P. & Ledoux, J. E. Disruptive effects of posttraining perirhinal cortex lesions on conditioned fear: contributions of contextual cues Behav. Neurosci. 109, 613–619 (1995). 5. Zhu, X. O. & Brown, M. W. Changes in neuronal activity related to the repetition and relative familiarity of visual stimuli in rhinal and adjacent cortex of the anesthetized rat. Brain Res. 689, 101–110 (1995). 6. Zhu, X. O., McCabe, B. J., Aggleton, J. P. & Brown, M. W. Mapping visual recognition memory through expression of the immediate early gene c-fos. Neuroreport 7, 1871–1875 (1996). 7. Bear, M. F. & Malenka, R. C. Synaptic plasticity: LTP and LTD. Curr. Opin. Neurobiol. 4, 389–399 (1994). 8. Kerr, D. S. & Abraham, W. C. LTD: Many means to how many ends? Hippocampus 6, 30–34 (1996). 9. Bear, M. F. & Abraham, W. C. Long-term depression in hippocampus. Annu. Rev. Neurosci. 19, 437–462 (1996). 10. Fujii, S., Saito, K., Miyakawa, H., Ito, K. & Kato, H. Reversal of long-term potentiation (depotentiation) induced by tetanus stimulation of the input to CA1 neurons of guinea pig hippocampal slices. Brain Res. 555, 112–122 (1991). 11. Mulkey, R. M. & Malenka, R. C. Mechanisms underlying induction of homosynaptic long-term depression in area CA1 of the hippocampus. Neuron 9, 967–975 (1992). 12. Dudek, S. M. & Bear, M. F. Homosynaptic long-term depression in area CA1 of hippocampus and effects of N-methyl-D-aspartate receptor blockade. Proc. Natl. Acad. Sci. USA 89, 4363–4367 (1992). 13. Bashir, Z. I. & Collingridge, G. L. An investigation of depotentiation of longterm potentiation in the CA1 region of the hippocampus. Exp. Brain Res. 100, 437–443 (1994). 14. Bolshakov, V. Y. & Siegelbaum, S. A. Postsynaptic induction and presynaptic expression of hippocampal long-term depression. Science 264, 1148–1152 (1994). 15. Oliet, S. H. R., Malenka, R. C. & Nicoll, R. A. Two distinct form of long-term depression coexist in CA1 hippocampal pyramidal cells. Neuron 18, 969–982 (1997). 16. Otani, S. & Connor, J. A. Requirement of rapid Ca2+ entry and synaptic activation of metabotropic glutamate receptors for the induction of long-term
156
depression in adult rat hippocampus. J. Physiol. (Lond.) 511, 761–770 (1998). 17. Fitzjohn, S. M. et al. The potent mGlu receptor antagonist LY341495 identifies roles for both cloned and novel mGlu receptors in hippocampal synaptic plasticity. Neuropharmacology 37, 1445–1458 (1998). 18. Mulkey, R. M., Herron, C. E. & Malenka, R. C. An essential role for protein phosphatases in hippocampal long-term depression. Science 261, 1051–1055 (1993). 19. Pin, J.-P. & Duvoisin, R. The metabotropic glutamate receptors: Structure and functions. Neuropharmacology 34, 1–26 (1995). 20. Conn, P. J. & Pin, J. P. Pharmacology and functions of metabotropic glutamate receptors. Annu. Rev. Pharmacol. Toxicol. 37, 205–237 (1997). 21. Anwyl, R. Metabotropic glutamate receptors: electrophysiological properties and role in plasticity. Brain Res. Rev. 29, 83–120 (1999). 22. Reyes, M. & Stanton, P. K. Induction of hippocampal long-term depression requires release of Ca2+ from separate presynaptic and postsynaptic intracellular stores. J. Neurosci. 16, 5951–5960 (1996). 23. Yokoi, M. et al. Impairment of hippocampal mossy fibre LTD in mice lacking mGluR2. Science 273, 645–647 (1996). 24. Domenici, M. R., Berretta, N. & Cherubini, E. Two distinct forms of longterm depression coexist at the mossy fiber-CA3 synapse in the hippocampus during development. Proc. Natl. Acad. Sci. USA 95, 8310–8315 (1998). 25. Tzounopoulos, T., Janz, R., Südhof, T. C., Nicoll, R. A. & Malenka, R. C. A role for cAMP in long-term depression at hippocampal mossy fiber synapses. Neuron 21, 837–845 (1998). 26. Huang, L. Q., Rowan, M. J. & Anwyl, R. mGluR II agonist inhibition of LTP induction, and mGluR II antagonist inhibition of LTD induction, in the dentate gyrus in vitro. Neuroreport 8, 687–693 (1997). 27. Manahan-Vaughan, D. Group 1 and 2 metabotropic glutamate receptors play differential roles in hippocampal long-term depression and long-term potentiation in freely moving rats. J. Neurosci. 17, 3303–3311 (1997). 28. Manahan-Vaughan, D. Priming of group 2 metabotropic glutamate receptors facilitates induction of long-term depression in the dentate gyrus of freely moving rats. Neuropharmacology 37, 1459–1464 (1998). 29. Bilkey, D. K. Long-term potentiation in the in vitro perirhinal cortex displays associative properties. Brain Res. 733, 297–300 (1996). 30. Ziakopoulos, Z., Tillet, C. W., Brown, M. W. & Bashir, Z. I. Input- and layerdependent synaptic plasticity in the rat perirhinal cortex in vitro. Neuroscience 92, 459–472 (1999). 31. Eaton, S. A. et al. Competitive antagonism at metabotropic glutamate receptors by (S)-4-carboxyphenylglycine and (R,S)-α-methyl-4carboxyphenylglycine. Eur. J. Pharmacol. 244, 195–197 (1993). 32. Bashir, Z. I. et al. Induction of LTP in the hippocampus needs synaptic activation of glutamate metabotropic receptors. Nature 363, 347–350 (1993). 33. Pellicciari, R. et al. 1-aminoindan-1,5-dicarboxylic acid: a novel antagonist at phosholipase C-linked metabotropic glutamate receptors. J. Med. Chem. 38, 3717–3719 (1995). 34. Moroni, F. et al. Pharmacological characterization of 1-aminoindan-1,5dicarboxylic acid, a potent mGluR1 antagonist. J. Pharmacol. Exp. Ther. 281, 721–729 (1997). 35. Salt, T. E. & Eaton, S. A. Distinct presynaptic metabotropic receptors for LAP4 and CCG1 on GABAergic terminals: pharmacological evidence using novel α-methyl derivative mGluR antagonists, MAP4 and MCCG, in the rat thalamus in vivo. Neuroscience 65, 5–13 (1995). 36. McCaffery, B. et al. Synaptic depression induced by pharmacological activation of metabotropic glutamate receptors in the perirhinal cortex in vitro. Neuroscience 93, 977–984 (1999). 37. Ito, I. et al. 3,5-Dihydroxyphenylglycine: a potent agonist of metabotropic glutamate receptors. Neuroreport 3, 1013–1016 (1992). 38. Wilsch, V. W., Pidoplichko, V. I., Opitz, T., Shinozaki, H. & Reymann, K. G. Metabotropic glutamate receptor agonist DCG-IV as NMDA receptor agonist in immature rat hippocampal neurones. Eur. J. Pharmacol. 262, 287–291 (1994). 39. Scanziani, M., Salin, P. A., Vogt, K. E., Malenka, R. C. & Nicoll, R. A. Usedependent increases in glutamate concentration activate presynaptic metabotropic glutamate receptors. Nature 385 630–634 (1997). 40. Schoepp, D. D. et al. The novel metabotropic glutamate receptor agonist 2R,4R- APDC potentiates stimulation of phosphoinositide hydrolysis in the rat hippocampus by 3,5–dihydroxyphenylglycine: Evidence for a synergistic interaction between group 1 and group 2 receptors. Neuropharmacology 35, 1661–1672 (1996). 41. Mistry, R., Golding, N. & Challiss, R. A. J. Regulation of phosphoinositide turnover in neonatal rat cerebral cortex by group I- and II-selective metabotropic glutamate receptor agonists. Br. J. Pharmacol. 123, 581–589 (1998). 42. Noel, J. et al. Surface expression of AMPA receptors in hippocampal neurones is regulated by an NSF-dependent mechanisms. Neuron 23, 365–376 (1999). 43. Doherty, A. J., Collingridge, G. L. & Jane, D. E. Antagonist activity of αsubstituted 4-carboxyphenylglycine analogues at group I metabotropic glutamate receptors expressed in CHO cells. Br. J. Pharmacol. 126, 205–210 (1999). 44. Burwell, R. D., Witter, M. P. & Amaral, D. G. Perirhinal and postrhinal cortices of the rat: A review of the neuroanatomical literature and comparison with findings from the monkey brain. Hippocampus 5, 390–408 (1995).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Polyglutamine expansion downregulates specific neuronal genes before pathologic changes in SCA1
© 2000 Nature America Inc. • http://neurosci.nature.com
Xi Lin1,2, Barbara Antalffy3, Dongcheul Kang1,2, Harry T. Orr4 and Huda Y. Zoghbi1,2 1
Howard Hughes Medical Institute, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA
2
Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA
3
Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA
4
Department of Laboratory Medicine and Pathology, Institute of Human Genetics, University of Minnesota, Harvard Street at East River Rd., Minneapolis, Minnesota 55455, USA Correspondence should be addressed to H.Y.Z. (
[email protected])
The expansion of an unstable CAG repeat causes spinocerebellar ataxia type 1 (SCA1) and several other neurodegenerative diseases. How polyglutamine expansions render the resulting proteins toxic to neurons, however, remains elusive. Hypothesizing that long polyglutamine tracts alter gene expression, we found certain neuronal genes involved in signal transduction and calcium homeostasis sequentially downregulated in SCA1 mice. These genes were abundant in Purkinje cells, the primary site of SCA1 pathogenesis; moreover, their downregulation was mediated by expanded ataxin-1 and occured before detectable pathology. Similar downregulation occurred in SCA1 human tissues. Altered gene expression may be the earliest mediator of polyglutamine toxicity.
Spinocerebellar ataxia type 1 and several other autosomal dominant neurodegenerative diseases are caused by expansions of a CAG trinucleotide repeat tract that result in an abnormally long polyglutamine tract within the mutated proteins. In SCA1, the degeneration afflicts primarily the cerebellar Purkinje cells and brainstem neurons, leading to the characteristic ataxic phenotype and bulbar dysfunction. There is persuasive evidence that the mutant proteins gain some toxic function1,2, but precisely what this new function might be and how a ubiquitous protein can cause the degeneration of only highly circumscribed neuronal populations remain some of the most puzzling questions in SCA1 pathogenesis. Mouse models yield important clues to this question. The B05 line, the primary SCA1 mouse model, expresses a full-length SCA1 cDNA with 82 CAG repeats (82Q) under the Purkinje cell-specific promoter of the Pcp2 gene and develops the ataxia and loss of motor coordination typical of the human disease phenotype3,4. These mice duplicate the Purkinje cell pathology seen in human patients, including the localization of the mutant ataxin-1 protein into a single nuclear aggregate5. A line of transgenic mice that expresses expanded ataxin-1 with a point mutation in the nuclear localization signal (so that the protein cannot be transported into the nucleus) fails to develop disease6. Another mouse line (77∆) expressing expanded ataxin-1 without a self-association domain fails to develop nuclear aggregates despite nuclear localization of the expanded protein—but does develop the SCA1 phenotype. These data clearly demonstrate that nuclear events, though not nuclear aggregation, mediate SCA1 pathogenesis. Furthermore, studies in transfected COS-1 cells show that mutant ataxin-1 associates with nuclear matrix and disrupts specific nuclear domains (such as promyelocytic oncogenic domains, PODs)5. Disruption of nuclear structures and functions might alter gene expression. In testing this hypothesis, we found several genes with nature neuroscience • volume 3 no 2 • february 2000
altered expression in the B05 mice3,4 using a PCR-based cDNA subtractive-hybridization strategy. Six neuronal genes, all highly abundant in Purkinje cells, were downregulated at a surprisingly early stage in pathogenesis, before any known behavioral or pathological changes. This downregulation required the nuclear localization of mutant ataxin-1 and occurred in two independent SCA1 mouse models. We also found upregulation of one gene, a homolog of human α1-antichymotrypsin (α1-ACT), at five weeks of age; this is most likely a secondary event in pathogenesis. Finally, all the alterations noted in SCA1 transgenic mice were also found in human SCA1 tissues. These data suggest that polyglutamine expansion in SCA1 may mediate early pathogenic events by downregulating the expression of specific neuronal genes.
RESULTS In B05 mice, the transgene expression was first detectable at postnatal day 10 (P10). The mice developed normally with no neurobehavioral abnormalities until five weeks of age, when they first showed mild impairment on the accelerating rotating rod. Purkinje cells begin to lose their proximal dendrites at six weeks3,4. To capture the full spectrum of genes that might be altered in SCA1 pathogenesis, we performed PCR-based cDNA subtraction using cerebellar mRNA from two-month-old B05 mice and wild-type littermates. The subtractions were done in two different directions, using B05 mRNA either as the tester or the driver, to identify genes that were up- or downregulated, respectively. Six hundred clones from the subtracted cDNA library were screened by dot-blot hybridization. Twenty clones that differentially hybridized to the subtracted probes were further examined with northern blots, from which nine clones representing seven different genes had altered expression patterns in B05 cerebellum. Differentially expressed clones were identified by sequence analysis. 157
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 1. PCCMT expression was specifically reduced in SCA1 mice. (a) Northern blots of cerebellar RNA from four different lines of SCA1 transgenic mice and wild-type (WT) littermates using PCCMT cDNA as a probe. B05 and A02 mice express human ataxin-1 with 82 and 30 glutamines, respectively. K772T mice express expanded ataxin-1 with 82 glutamines and a point mutation in the nuclear localization signal (K772T). 77∆ mice express ataxin-1 with 77 glutamines and no self-association domain. Substantially reduced PCCMT mRNA expression was seen in B05 and 77∆ mice, but not in A02 and K772T mice. The ages of animals used in this experiment were eight weeks for B05 and A02 and five weeks for 77∆ and K772T. The β-actin hybridization signal demonstrates equal loading of RNA for littermate pairs at various time points. (b) Northern blots of cerebellar RNA from B05 mice and WT littermates at different ages using PCCMT cDNA as a probe. Expression of PCCMT mRNA was reduced by postnatal day 11. The similar amount of RNA between B05 and WT littermates was shown by the equal β-actin hybridization signal.
a
b
To determine whether these altered expression levels might mediate early pathogenesis, we examined the expression of these genes in younger mice, before any histologic or neurobehavioral abnormalities develop. Because mutant animals do not begin to display Purkinje cell pathology until six weeks4, we reasoned that changes of gene expression before three weeks would be less likely to represent secondary events in pathogenesis. We ascertained the earliest date of altered expression for each gene by northern blot analyses on total-RNA samples collected at different time points from B05 mice or normal littermates. The characterization of these genes and their alterations in SCA1 is detailed in the following sections. Cloning and characterization of mouse PCCMT One of the clones identified by cDNA subtractive hybridization was isolated repeatedly and found to contain a 550-bp insert. Sequencing and BLAST searches revealed no significant homology to any known sequences in the databases. Northern blots using the 550bp insert as a probe identified a 4.8-kb transcript, which was dramatically downregulated in B05 cerebellum (Fig. 1a, B05). Subsequent screening of a mouse brain cDNA library (Stratagene, La Jolla, California) allowed the isolation of a clone that contained a 4,730-bp insert (GenBank accession number, AF209926). Assembly of this 4,730-bp sequence with that of an EST clone (AA022288) resulted in a cDNA of 4,846 bp and predicted an open reading frame of 852 bp that was highly homologous to the coding regions of human (88% identity) and Xenopus (71% identity) prenylcysteine carboxylmethyltransferase (PCCMT)7,8. This clone was therefore identified as a mouse homolog of PCCMT. Immunohistochemistry using a rabbit polyclonal antibody against a peptide (amino acids 185–200) from human PCCMT protein, equivalent to the predicted mouse protein amino acids 184–199, showed abundant staining in the Purkinje cells of wild-type mice and sparse staining in B05 Purkinje cells (data not shown). To evaluate the potential roles of PCCMT in early SCA1 pathogenesis, we examined PCCMT mRNA expression at different time points in B05 and wild-type littermate cerebella. Remarkably, the 158
reduction in PCCMT mRNA level was already detectable in B05 cerebella at P11 (Fig. 1b), about one day after the initiation of SCA1 transgene expression and two weeks before the earliest morphologic changes3,4. Moreover, this reduction was consistently observed in multiple experiments using RNA from different litters of mice. Phosphoimaging analysis confirmed that the reduction of PCCMT mRNA expression was statistically significant, with an 11 ± 2.36% decrease at day 11 and a 19.2 ± 7.5% decrease at day 15 (n = 3, p < 0.05). Thus PCCMT downregulation occurred very early. We examined PCCMT mRNA expression in other SCA1 transgenic mouse lines that show no obvious Purkinje cell dysfunction or degeneration (A02 mice and ataxin-1[82Q]K772T mice)4,6. A02 mice express high levels of wild-type human ataxin-1 with 30 glutamines (30Q); mice expressing ataxin-1[82Q]K772T with a point mutation in the nuclear-localization signal retain mutant ataxin1 in the cytoplasm, where it is nonpathogenic. Neither line showed altered PCCMT mRNA levels (Fig. 1a, A02 and K772T). In contrast, PCCMT mRNA was dramatically decreased in another SCA1 mouse model (77∆) that manifests behavioral and pathological changes similar to those of B05 mice (Fig. 1a, 77∆). To study the function of PCCMT in mice, we examined its expression during development and in various peripheral tissues in northern blots. PCCMT mRNA was highly enriched in adult cerebellum, with low levels of expression in other brain regions (Fig. 2a) and very low but detectable (after prolonged exposure) levels in peripheral tissues such as lung, heart, kidney and skeletal muscles (Fig. 2b). Within the cerebellum, PCCMT mRNA was expressed postnatally, with a dramatic increase after P12 (Fig. 2c). The temporal and spatial expression pattern of PCCMT suggests that it might have an important role in Purkinje cells. To determine whether PCCMT was expressed in neurons vulnerable to SCA1, we examined PCCMT mRNA expression in the human brain (Fig. 2d). Northern blots using mRNA isolated from different brain regions showed that PCCMT was expressed in the cerebellum and putamen at higher levels than in other brain regions and revealed three different transcripts of 9.0 kb, 5.5 kb nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 2. PCCMT mRNA expression in mouse and d a human brain. (a–c) Northern blots using PCCMT cDNA as a probe and total RNA (25 µg) from different brain regions of adult WT mice (a), thalamus and several peripheral tissues of B05 and WT littermates at two months of age (b), and cerebella of WT mice at different developmental stages (c). Ethidium bromide-stained RNA gel images e b are shown for loading control, which was confirmed by hybridization with β-actin cDNA (not shown). PCCMT was predominantly expressed in cerebellum, with much lower levels of expression in other regions of the brain (a, one-day exposure). In the peripheral tissues, PCCMT was detectable only after long exposure (b, three-day exposure). During cerebellar c development, PCCMT expression was low before P6 and dramatically increased after P12. (d) Northern blot of polyA RNA (2 µg) from the indicated regions of human brain probed with PCCMT cDNA shows the relatively high levels of expression in the cerebellum and putamen. Equal loading in each lane was confirmed by hybridization with β-actin cDNA as a probe (not shown). (e) Immunohistochemical staining of PCCMT in the cerebella and pons of a SCA1 patient and an age-matched control demonstrates much-reduced expression in Purkinje cells and pontine neurons in the patient.
and 3.6 kb, of which the 5.5 kb was most abundant (Fig. 2d). It remains unknown whether these transcripts represent alternatively spliced isoforms or distinct homologs. Immunohistochemical analysis using an antibody against human PCCMT found abundant expression in Purkinje cells and pontine neurons (Fig. 2e, control). We also examined PCCMT expression in human brain tissue from a juvenile-onset SCA1 patient, focusing on the cerebellum and pons, two regions typically affected in SCA1. Little PCCMT immunostaining was found in the cerebellum (Fig. 2e, Cerebellum, SCA1). This might be due in part to the paucity of remaining Purkinje cells in this patient. The pons, however, which retained many pontine neurons, showed greatly reduced PCCMT immunostaining (Fig. 2e, Pons, SCA1). Although it is impossible to investigate the role of PCCMT in early SCA1 pathogenesis in humans, these snapshots of end-stage disease are in accordance with the alterations observed in transgenic mice. IP3R1 and SERCA2 are downregulated at P14 Sequence analysis of two other subtracted clones showed 100% identity to mouse inositol triphosphate receptor type 1 (IP3R1) and sarcoplasmic endoplasmic reticulum calcium ATPase type 2 (SERCA2), two Purkinje cell-abundant proteins. IP3R1 and SERCA2, an intracellular Ca2+-release channel and a Ca2+ pump, respectively, are both present on the membrane of the endoplasmic reticulum (ER). The nature neuroscience • volume 3 no 2 • february 2000
mRNAs of IP3R1 and SERCA2 are downregulated at two weeks of age in B05 mouse cerebellum, again, preceding known behavioral or morphological changes (Fig. 3a). Immunohistochemistry using either an IP3R1- or SERCA2-specific polyclonal antibody on cerebellar sections from six-week-old mice revealed dramatic reductions in IP3R1 and SERCA2 proteins in B05 cerebellar Purkinje cells (data not shown). Similar downregulations in IP3R1 and SERCA2 mRNA occurred in mice expressing ataxin-1[77Q]∆, but not in A02 mice or mice expressing ataxin-1[82Q]K772T (data not shown). Therefore, downregulation of IP3R1 and SERCA2 specifically occurs in the transgenic mice that show Purkinje cell degeneration caused by mutant ataxin-1. Immunohistochemistry using IP3R1 (not shown) and SERCA2 (Fig. 3b) antibodies revealed profoundly reduced immunostaining in cerebellar Purkinje cells and pontine neurons from SCA1 patient tissues. Downregulation of 5-phosphatase, mTRP3 and EAAT4 Three genes were downregulated by three to four weeks of age in B05 mouse cerebellum: type 1 inositol polyphosphate 5-phosphatase (5-phosphatase; Fig. 4a), transient receptor potential type 3 (TRP3; Fig. 4b) and excitatory amino acid transporter type 4 (EAAT4; Fig. 4c). Type 1 inositol polyphosphate 5-phosphatase is a major inactivating enzyme of IP3 and IP4, which mobilize Ca2+ through interactions with the intracellular calcium release channels, IP3Rs9. TRP3 159
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 3. IP3R1 and SERCA2 expression is reduced in SCA1 mice and patient brain tissues. (a) Northern blots of total cerebellar RNA (25 µg) from B05 mice and WT littermates at different ages using IP3R1 or SERCA2 cDNA as probe. IP3R1 and SERCA2 mRNAs are reduced in B05 cerebellum at two weeks of age. Equal loading of RNA in each lane is shown by similar intensity of ethidium bro mide-stained 28S and 18S rRNAs. (Hybridization signal of β-actin is not shown.) (b) Immunohistochemical staining of SERCA2 in the cerebellum and pons of a SCA1 patient and an age-matched control.
a
is a putative plasmalemmal calcium channel controlled by the content or filling state of calcium stores through some unknown mechanism10. Transcripts of these two genes were dramatically reduced at four weeks of age in B05 mouse cerebellum (Fig. 4a and b). These downregulations probably reflected reduced expression in Purkinje cells, as type 1 inositol 5-phosphatase and TRP3 are predominantly expressed in Purkinje cells in the cerebellum. EAAT4 is a Purkinje cell-specific glutamate transporter localized on dendritic spines11. In B05 cerebellum, EAAT4 mRNA downregulation was obvious at three weeks of age. By six weeks, EAAT4 protein was hardly detectable in Purkinje cells by immunohistochemistry using an EAAT4-specific polyclonal antibody (Fig. 4c). Analysis of the expression patterns of these three genes in the other SCA1 transgenic mice demonstrated that their downregulation was associated specifically with pathogenic mutant ataxin-
a
b
b
1, as downregulation occurred in ataxin-1[77Q]∆ mice but not A02 or ataxin-1[82Q]K772T mice (data not shown). Purkinje cell gene expression was not globally altered To rule out the possibility that downregulation might be a global effect, we looked at the expression patterns of eight other genes known to be abundant in Purkinje cells in three-month-old B05 mice and wild-type littermates. Among those examined were cGMP binding-phosphodiesterase (cGB-PDE), phospholipase Cβ4 (PLCβ4) and IP3 3-kinase (IP3-3K)12–14. There were no apparent changes in the expression of any of the eight genes in B05 mouse cerebellum (three examples shown in Fig. 5). Mouse α1-antichymotrypsin upregulated at five weeks Not all the genes identified with our subtractive hybridization approach were downregulated in B05 mice. One clone was upregulated. Sequence analysis revealed that this clone was identical to EB22/4, a serine protease inhibitor isolated from a mouse teratocarcinoma cell line and presumably the physiological homolog of human α1-antichymotrypsin (61% amino acid identity)15. Northern blots showed a single transcript of ∼2 kb (Fig. 6a). In B05 cerebellum, EB22/4 mRNA was upregulated by five weeks (Fig. 6b), whereas no change was detected in A02 mice (Fig. 6a). EB22/4 mRNA was also increased in ataxin-1[77Q]∆ mouse cerebellum (Fig. 6a), consistent with the pathology of Purkinje cell degeneration. Surprisingly, we observed an increase in EB22/4 in ataxin-1[82Q]K772T mice (Fig. 6a), which have no obvious Purkinje cell
c Fig. 4. Downregulation of type 1 inositol polyphosphate 5phosphatase, TRP3 and EAAT4 in SCA1 mice. Northern blots of cerebellar RNA (25 µg) from B05 mice and WT littermates at different ages were probed with 5-phosphatase 1 (a), TRP3 (b) and EAAT4 (c) cDNAs. Equal amount of total RNA in each lane was confirmed by similar β-actin hybridization signals and ethidium bromide staining of the gel (not shown). (a, b) At four weeks of age, inositol polyphosphate 5-phosphatase type 1 and TRP3 showed reduced expression in B05 cerebellum. (c) At three weeks, EAAT4 mRNA is reduced. Immunohistochemical staining of EAAT4 in B05 and WT littermate mouse cerebella at six weeks of age showed greatly reduced EAAT4 protein in Purkinje cell dendrites. 160
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 5. Mutant ataxin-1 does not affect expression of all Purkinje cellspecific genes. Northern blots of total cerebellar RNA (25 µg) from three-month-old B05 mice and WT littermates using the indicated cDNAs as probes. The mRNA levels of cGMP binding-phosphodiesterase (cGB-PDE), phospholipase Cβ4 (PLCβ4) and IP3 3-kinase (IP33K) are similar between B05 and WT.
degeneration but do express mutant ataxin-1 in the cytoplasm. Unlike the other genes characterized above, EB22/4 mRNA upregulation thus seemed to depend on the polyglutamine expansion in ataxin-1, but not on nuclear localization of its product. Because EB22/4 is highly homologous to human α1-ACT and anti-human α1-ACT polyclonal antibodies recognize a single band on western blots of mouse tissues16, we examined α1-ACT-like protein (EB22/4) expression by immunohistochemistry. The white matter of B05 mouse cerebellum showed intense α1-ACT-antibody staining, whereas wild-type mouse cerebellum showed a very low level of staining (Fig. 6c). This staining pattern suggests that upregulation of α1-ACT-like protein in SCA1 mouse cerebellum was a response secondary to mutant ataxin-1 expression in the Purkinje cells. It is interesting that, in SCA1 patient tissue, α1ACT stains intensely in neuronal cytoplasm (Fig. 6d).
DISCUSSION We identified and characterized several specific genes whose expression was altered in SCA1 transgenic mice at unexpectedly early stages in pathogenesis. This downregulation is the earliest known effect of mutant ataxin-1, occurring before any detectable pathological changes. This effect of mutant ataxin-1 is selective: a number of other Purkinje cell-specific genes were not altered. Moreover, the downregulation seemed to occur sequentially, with PCCMT affected first, followed by IP3R1, SERCA2, EAAT4, TRP3 and 5-phosphatase 1. The finding that downregulation of the same genes occurred in two independent SCA1 mouse models (B05 and [77Q]∆) and not in mice overexpressing non-pathogenic ataxin-1 (A02 and mice expressing ataxin-1[82Q]K772T) makes it plausible that reduced expression of these genes is involved in SCA1 pathogenesis. Substantially reduced immunostaining of PCCMT, SERCA2 and IP3R1 in human SCA1 brain tissues corroborated the mouse data and suggested that expression of these genes is altered in human SCA1 pathogenesis as well. To rule out the remote possibility that this downregulation was secondary to Purkinje cell distress, we evaluated the expression pattern of PCCMT, SERCA2 and TRP3 in two mouse mutants that have dysfunctional Purkinje cells, Ube3a and Sca1 knockouts2,17. No alterations in gene expression were detected (data not shown). EB22/4 was the only gene we found to be upregulated. Available evidence suggests that mouse EB22/4 is the physiological homolog of human α1-antichymotrypsin15, a serine protease nature neuroscience • volume 3 no 2 • february 2000
inhibitor and an acute response protein involved in a variety of pathological conditions. In the brain, α1-antichymotrypsin is expressed in glia; its expression is increased in Alzheimer disease, Huntington disease and normal aging18–20, and it may well be involved in similar molecular events in these different pathophysiological conditions. The observation that EB22/4 was also upregulated in K772T mice indicates its dependence on the expression, but not the nuclear localization, of mutant ataxin-1. Although K772T mice do not exhibit abnormalities, their Purkinje cells might respond in subtle ways to the presence of expanded ataxin1 in the cytoplasm. Excessive quantities of misfolded ataxin-1 in the cytoplasm could elicit enough of a stress response to affect cellular functions, if not cause actual degeneration. EAAT4, TRP3 and inositol polyphosphate 5-phosphatase type 1 were downregulated in B05 cerebellum by three to four weeks of age. EAAT4 is a Purkinje cell-specific glutamate transporter localized to the extra-junctional dendritic membrane. It presumably restricts glutamate spillover to adjacent synapses and enhances spatial and temporal resolution of glutamate signaling11,21. TRP3, a calcium channel abundant in Purkinje cell membranes, is involved in cellular calcium homeostasis10,22,23. Inositol polyphosphate 5-phosphatase type 1 is the major inactivating enzyme of calcium-mobilizing molecules IP3 and IP4 and is involved in the regulation of calcium signaling9,24,25. In both human and rat brains, inositol 5-phosphatase type 1 is highly abundant in the Purkinje cells12,26. Specific downregulation of inositol 5-phosphatase type 1 and TRP3 suggests that calcium homeostasis may be perturbed in SCA1 pathogenesis. At two weeks, IP3R1 expression and SERCA2 expression were reduced in B05 mice. Both of these proteins localize to the endoplasmic reticulum and are involved in calcium store regulation27–29. IP3R1 is a calcium-release channel and increases free cytoplasmic calcium concentration ([Ca2+]cyt) by releasing Ca2+ from the ER in response to IP3 generated by extracellular signals. Interestingly, lack of IP3R1 due to either spontaneous mutation or targeted deletion leads to severe ataxia, seizures and premature death in mice30,31. SERCA2, an ATPase, balances IP3R1 by pumping calcium into the ER, effectively reducing [Ca2+]cyt. The abundance of IP3R1 and SERCA2 in cerebellar Purkinje cells reflects their importance in regulating calcium levels32–34. The net effect of IP3R1 and SERCA2 downregulation on [Ca2+]cyt in Purkinje cells may not be straightforward, however. Depending on the relative contributions of IP3R1 and SERCA2, average [Ca2+]cyt could increase, decrease or not change. Even subtle changes in calcium transients might lead to Purkinje cell dysfunction and progressive degeneration in SCA135,36. The cellular calcium signaling system is markedly flexible and adaptable, and expression of different components are interdependent37. It thus seems probable that downregulating IP3R1 and/or SERCA2 leads to changes in the expression of the other genes by a cellular compensatory mechanism that then resets the cellular calcium-signaling system. Because the expression of expanded ataxin-1 in SCA1 mouse Purkinje cells is not transient (it is driven by the potent Pcp2/L7 promoter), the constant, high level of mutant ataxin-1 might pose a sustained stress signal to the calcium signaling system. PCCMT, whose expression was altered first, is an abundant Purkinje cell protein in both mouse and human cerebella; it is involved in the posttranslational modification of a number of very important cellular proteins, including Ras-like small GTPases, heterotrimeric G protein γ subunits and nuclear lamins38–40. Inhibiting PCCMT activity impairs membrane targeting of Ras in transfected cells41. Downregulation of PCCMT in cerebellar Purk161
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
© 2000 Nature America Inc. • http://neurosci.nature.com
b
c
d
inje cells could strain the normal functions of these molecules and have adverse effects on many aspects of cellular physiology. Alternatively, the reduced expression of PCCMT (as well as IP3R1 and SERCA2) in early developmental stages might perturb Purkinje cell differentiation and/or render the cells more susceptible to stress. It is striking that all the genes whose expression was altered early in the pathogenesis in SCA1 mouse models were downregulated; perhaps a common mechanism operated at transcriptional and/or posttranscriptional levels. Because expanded ataxin-1 has to localize to Purkinje cell nuclei to cause neuronal degeneration6, we favor a model of transcriptional downregulation. Expanded ataxin-1 might interact directly with certain transcription factors and coactivators, thus interfering specifically with the transcription of their target genes. Alternatively, expanded ataxin-1 might affect transcription indirectly, possibly by perturbing nuclear proteasomal activity42. Some transcription factors, such as NFκB, p53, nuclear receptors and their cofactors, are regulated by proteasomal degradation43–46. Ataxin-1 colocalizes with proteasomal components in nuclear aggregates in the Purkinje cells of both SCA1 transgenic mice and patients42. Proteasomal perturbation by mutant ataxin-1 in the nucleus could lead to downregulation of certain genes through either increased degradation of their activators and/or decreased degradation of their repressors, depending on how the proteasomal activity is modulated by expanded ataxin1. Regardless, identification of genes downregulated in SCA1 makes it possible for future studies to evaluate this hypothesis. Mutant ataxin-1 might also downregulate gene expression by disrupting nuclear structures and nuclear protein functions. For example, mutant ataxin-1 redistributes PML5, which interacts with CBP/p300 and facilitates CBP/p300 localization to PODs47. PML enhances the activity of nuclear receptors as transactivators in mammalian cells, suggesting that it could be a transcriptional co-activator. It is possible that, by redistributing PML, mutant ataxin-1 interferes with its normal function as a transcriptional co-activator, resulting in reduced expression of specific groups of genes. It will be worthwhile to determine if the genes whose expression is altered by mutant ataxin-1 are regulated by nuclear receptors and PML. Alternatively, mutant ataxin-1 might alter gene expression by interfering with mRNA metabolism through various nuclear events, such as mRNA processing and mRNA nucleocytoplasmic transport. These possibilities can be explored in the SCA1 mouse models by studying the regulation of the genes identified in this study. Identifying genes whose expression is altered by mutant ataxin1 provides a platform for further studies aimed at understanding the earliest molecular events disrupted in SCA1 pathogenesis. Characterization of the transcriptional regulation of these genes should yield greater insight into not only the molecular mechanisms by which expanded ataxin-1 affects gene expression, but the pathogenesis of other polyglutamine diseases as well.
METHODS Fig. 6. Upregulation of EB22/4, a mouse homolog of human α1-ACT. (a, b) Northern blots of total cerebellar RNA (25 µg) from different lines of SCA1 transgenic mice and WT littermates at five to eight weeks of age (a) and B05 mice and WT littermates at different ages (b) were probed with EB22/4 cDNA. EB22/4 expression is increased not only in B05 and 77∆ mice, but also in K772T mice. The increase of EB22/4 expression in B05 cerebellum was obvious by five weeks of age. (c, d) Immunohistochemical staining for α1-ACT in B05 and WT littermate mouse cerebella at three months of age (c) as well as the pons of a SCA1 patient and age-matched control (d). Staining for α1-ACT is increased in the white matter of B05 cerebellum (c) and in pontine neurons of the SCA1 patient (d). 162
Northern blots. Total RNA was isolated from different mouse tissues with TRIZOL reagent following manufacturer’s instructions (Gibco-BRL, Gaithersburg, Maryland). RNA (25 µg) was fractionated and transferred to nylon membrane according to standard protocol. Various probes were labeled using Megaprime kit (Amersham, Cleveland, Ohio) and hybridized in ExpressHyb hybridization solution (Clontech, Palo Alto, California) according to manufacturer’s instruction. The relative amounts of RNA on the blots were evaluated by both ethidium bromide-stained RNA gel images and hybridization using β-actin cDNA as a probe. Subtractive cDNA cloning. To identify genes with altered expression patterns in B05 mice, we performed subtractive cDNA cloning using Clontech nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
PCR-Select cDNA Subtraction Kit (Clontech). Briefly, total RNA was isolated from the cerebella of two-month-old B05 mice and wild-type, sexmatched littermates using TRIZOL as described above. mRNA was then selected using Dynabeads Oligo(dT)25 (Dynal A. S., Oslo, Norway). We then precisely followed the protocol of PCR-Select cDNA Subtraction Kit provided by the manufacturer. Potential, differentially expressed clones were verified by northern blots of wild-type and B05 cerebellar RNA using the cDNA insert as a probe. Sequences of the differentially expressed clones were obtained by ABI PrismTM DNA Sequencer and BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, Foster City, California). The sequences were analyzed by DNASTAR program and BLAST search. Immunohistochemistry. The immunohistochemical staining on mouse brain sections was performed as described previously5. The rabbit polyclonal anti-PCCMT antibody, a gift from Mark Philips7, was used at 1:800 dilution. The rabbit anti-IP3R1 antibody (sc6093, Santa Cruz, Santa Cruz, California) was used at 1:100 dilution. The anti-SERCA2 monoclonal antibody (Novocastra Laboratories, Newcastle, UK) was used at 1:50 dilution. The rabbit anti-α1-ACT antibody (Zymed Laboratories, San Francisco, California) was used at 1:50 dilution. The rabbit antiEAAT4 antibody, provided by Kohichi Tanaka and Kei Watase11,21, was used at 0.1 mg per ml.
ACKNOWLEDGEMENTS The authors thank A. Beaudet for providing the Ube3a null mice, M. Philips at New York University School of Medicine and K. Tanaka at the National Institute of Neuroscience in Japan for providing the anti-PCCMT and anti-EAAT4 antibodies, H. J. Bellen for reading the manuscript and V. Brandt for comments. This work was supported by grants NS27699 and NS22920 from the National Institutes of Health (to H.Y.Z. and H.T.O.) and by the core facilities of the Baylor College of Medicine Mental Retardation Research Center. X. Lin is an Associate and H. Zoghbi an Investigator with the Howard Hughes Medical Institute.
RECEIVED 20 SEPTEMBER; ACCEPTED 6 DECEMBER 1999 1. Zoghbi, H. Y. & Orr, H. T. Spinocerebellar ataxia type 1. Seminars in Cell Biology: Unstable Repeat Diseases Vol. 6, 29–35 (Saunders, Philadelphia, 1995). 2. Matilla, A. et al. Mice lacking ataxin-1 display learning deficits and decreased hippocampal paired-pulse facilitation. J. Neurosci. 18, 5508–5516 (1998). 3. Burright, E. N. et al. SCA1 transgenic mice: a model for neurodegeneration caused by an expanded CAG trinucleotide repeat. Cell 82, 937–948 (1995). 4. Clark, H. B. et al. Purkinje cell expression of a mutant allele of SCA1 in transgenic mice leads to disparate effects on motor behaviors, followed by a progressive cerebellar dysfunction and histological alterations. J. Neurosci. 17, 7385–7395 (1997). 5. Skinner, P. J. et al. Ataxin-1 with extra glutamines induces alterations in nuclear matrix-associated structures. Nature 389, 971–974 (1997). 6. Klement, I. A. et al. Ataxin-1 nuclear localization and aggregation: Role in polyglutamine-induced disease in SCA1 transgenic mice. Cell 95, 41–53 (1998). 7. Dai, Q. et al. Mammalian prenylcysteine carboxyl methyltransferase is in the endoplasmic reticulum. J. Biol. Chem. 273, 15030–15034 (1998). 8. Imai, Y., Davey, J., Kawagishi-Kobayashi, M. & Yamamoto, M. Genes encoding farnesyl cysteine carboxyl methyltransferase in Schizosaccharomyces pombe and Xenopus laevis. Mol. Cell. Biol. 17, 1543–1551 (1997). 9. Mitchell, C. A., Brown, S., Campbell, J. K., Munday, A. D. & Speed, C. J. Regulation of second messengers by the inositol polyphosphate 5-phosphatases. Biochem. Soc. Trans. 24, 994–1000 (1996). 10. Mori, Y. et al. Differential distribution of TRP Ca2+ channel isoforms in mouse brain. Neuroreport 9, 507–515 (1998). 11. Yamada, K. et al. EAAT4 is a post-synaptic glutamate transporter at Purkinje cell synapses. Neuroreport 7, 2013–2017 (1996). 12. Mailleux, P., Takazawa, K., Erneux, C. & Vanderhaeghen, J. J. Comparison of neuronal inositol 1,4,5-trisphosphate 3-kinase and receptor mRNA distributions in the adult rat brain using in situ hybridization histochemistry. Neuroscience 49, 577–590 (1992). 13. Kotera, J. et al. Expression of rat cGMP-binding cGMP-specific phosphodiesterase mRNA in Purkinje cell layers during postnatal neuronal development. Eur. J. Biochem. 249, 434–442 (1997). 14. Roustan, P. et al. The rat phospholipase C beta 4 gene is expressed at high abundance in cerebellar Purkinje cells. Neuroreport 6, 1837–1841 (1995). 15. Inglis, J. D., Lee, M., Davidson, D. R. & Hill, R. E. Isolation of two cDNAs encoding novel alpha 1-antichymotrypsin-like proteins in a murine chondrocytic cell line. Gene 106, 213–220 (1991).
nature neuroscience • volume 3 no 2 • february 2000
16. Akaaboune, M., Ma, J., Festoff, B. W., Greenberg, B. D. & Hantai, D. Neurotrophic regulation of mouse muscle beta-amyloid protein precursor and alpha 1antichymotrypsin as revealed by axotomy. J. Neurobiol. 25, 503–514 (1994). 17. Jiang, Y. H. et al. Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron 21, 799–811 (1998). 18. Abraham, C. R., Selkoe, D. J. & Potter, H. Immunochemical identification of the serine protease inhibitor alpha 1-antichymotrypsin in the brain amyloid deposits of Alzheimer’s disease. Cell 52, 487–501 (1988). 19. Das, S. & Potter, H. Expression of the Alzheimer amyloid-promoting factor antichymotrypsin is induced in human astrocytes by IL-1. Neuron 14, 447–456 (1995). 20. Koo, E. H., Abraham, C. R., Potter, H., Cork, L. C. & Price, D. L. Developmental expression of alpha 1-antichymotrypsin in brain may be related to astrogliosis. Neurobiol. Aging 12, 495–501 (1991). 21. Tanaka, J., Ichikawa, R., Watanabe, M., Tanaka, K. & Inoue, Y. Extra-junctional localization of glutamate transporter EAAT4 at excitatory Purkinje cell synapses. Neuroreport 8, 2461–2464 (1997). 22. Birnbaumer, L. et al. On the molecular basis and regulation of cellular capacitative calcium entry: roles for Trp proteins. Proc. Natl. Acad. Sci. USA 93, 15195–15202 (1996). 23. Zhu, X. et al. trp, a novel mammalian gene family essential for agonist-activated capacitative Ca2+ entry. Cell 85, 661–671 (1996). 24. Drayer, A. L. et al. The family of inositol and phosphatidylinositol polyphosphate 5-phosphatases. Biochem. Soc. Trans. 24, 1001–1005 (1996). 25. Woscholski, R. & Parker, P. J. Inositol lipid 5-phosphatases—traffic signals and signal traffic. Trends Biochem. Sci. 22, 427–431 (1997). 26. De Smedt, F., Verjans, B., Mailleux, P. & Erneux, C. Cloning and expression of human brain type I inositol 1,4,5-trisphosphate 5-phosphatase. High levels of mRNA in cerebellar Purkinje cells. FEBS Lett. 347, 69–72 (1994). 27. Takei, K. et al. Ca2+ stores in Purkinje neurons: endoplasmic reticulum subcompartments demonstrated by the heterogeneous distribution of the InsP3 receptor, Ca2+-ATPase, and calsequestrin. J. Neurosci. 12, 489–505 (1992). 28. Villa, A. et al. The endoplasmic reticulum of Purkinje neuron body and dendrites: molecular identity and specializations for Ca2+ transport. Neuroscience 49, 467–477 (1992). 29. Volpe, P., Nori, A., Martini, A., Sacchetto, R. & Villa, A. Multiple/heterogeneous Ca2+ stores in cerebellum Purkinje neurons. Comp. Biochem. Physiol. Comp. Physiol. 105, 205–211 (1993). 30. Matsumoto, M. et al. Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4,5-trisphosphate receptor. Nature 379, 168–171 (1996). 31. Street, V. A. et al. The type 1 inositol 1,4,5-trisphosphate receptor gene is altered in the opisthotonos mouse. J. Neurosci. 17, 635–645 (1997). 32. Miller, K. K., Verma, A., Snyder, S. H. & Ross, C. A. Localization of an endoplasmic reticulum calcium ATPase mRNA in rat brain by in situ hybridization. Neuroscience 43, 1–9 (1991). 33. Nakanishi, S., Maeda, N. & Mikoshiba, K. Immunohistochemical localization of an inositol 1,4,5-trisphosphate receptor, P400, in neural tissue: studies in developing and adult mouse brain. J. Neurosci. 11, 2075–2086 (1991). 34. Ross, C. A., Danoff, S. K., Schell, M. J., Snyder, S. H. & Ullrich, A. Three additional inositol 1,4,5-trisphosphate receptors: molecular cloning and differential localization in brain and peripheral tissues. Proc. Natl. Acad. Sci. USA 89, 4265–4269 (1992). 35. Berridge, M. J. Neuronal calcium signaling. Neuron 21, 13–26 (1998). 36. Verkhratsky, A. & Toescu, E. C. Calcium and neuronal aging. Trends Neurosci .21, 2–7 (1998). 37. Liu, B. F., Xu, X., Fridman, R., Muallem, S. & Kuo, T. H. Consequences of functional expression of the plasma membrane Ca2+ pump isoform 1a. J. Biol. Chem. 271, 5536–5544 (1996). 38. Rando, R. R. Chemical biology of protein isoprenylation/methylation. Biochim. Biophys. Acta 1300, 5–16 (1996). 39. Clarke, S. Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochem. 61, 355–386 (1992). 40. Hrycyna, C. A. & Clarke, S. Modification of eukaryotic signaling proteins by Cterminal methylation reactions. Pharmacol. Ther. 59, 281–300 (1993). 41. Choy, E. et al. Endomembrane trafficking of ras: the CAAX motif targets proteins to the ER and Golgi. Cell 98, 69–80 (1999). 42. Cummings, C. J. et al. Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Nat. Genet. 19, 148–154 (1998). 43. Ciechanover, A. The ubiquitin-proteasome proteolytic pathway. Cell 79, 13–21 (1994). 44. Masuyama, H. & MacDonald, P. N. Proteasome-mediated degradation of the vitamin D receptor (VDR) and a putative role for SUG1 interaction with the AF2 domain of VDR. J. Cell. Biochem. 71, 429–440 (1998). 45. Nawaz, Z., Lonard, D. M., Dennis, A. P., Smith, C. L. & O’Malley, B. W. Proteasome-dependent degradation of the human estrogen receptor. Proc. Natl. Acad. Sci. USA 96, 1858–1862 (1999). 46. Zhang, J., Guenther, M. G., Carthew, R. W. & Lazar, M. A. Proteasomal regulation of nuclear receptor corepressor-mediated repression. Genes Dev. 12, 1775–1780 (1998). 47. Doucas, V., Tini, M., Egan, D. A. & Evans, R. M. Modulation of CREB binding protein function by the promyelocytic (PML) oncoprotein suggests a role for nuclear bodies in hormone signaling. Proc. Natl. Acad . Sci. USA 96, 2627–2632 (1999).
163
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
High-resolution mapping of isoorientation columns by fMRI Dae-Shik Kim, Timothy Q. Duong and Seong-Gi Kim Center for Magnetic Resonance Research, University of Minnesota Medical School, 2021 6th Street S.E., Minneapolis, Minnesota 55455, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to S.-G.K.(
[email protected])
Blood-oxygenation level-dependent (BOLD) functional magnetic resonance imaging (fMRI) is an important tool for localizing brain functions in vivo. However, the ability of BOLD fMRI to map cortical columnar structures is highly controversial, as the ultimate functional specificity of BOLD remains unknown. Here we report a biphasic BOLD response to visual stimulation in the primary visual cortex of cats. In functional imaging, the initial BOLD signal decrease accurately labeled individual isoorientation columns. In contrast, the delayed positive BOLD changes indicated the pattern of overall activation in the visual cortex, but were less suited to discriminate active from inactive columns.
Localization is a principle that is widely used in brain: cytoarchitectonically distinct areas form the basis for functional specialization1. Such parcellation of the cortical tissue into functional subunits is especially prominent at the level of individual cortical columns. In visual cortex of mammals, neurons with similar response properties such as ocular dominance or orientation preference are clustered into columns, spanning the entire cortical plate from the pia to white matter2–4. Studies of the structure, function and plasticity of cortical columns using a variety of traditional mapping techniques, however, suffer from fundamental limitations. For example, intra- and extracellular recordings yield insufficient field of view, and the 2-deoxyglucose5 technique is not viable for mapping in vivo. The optical imaging of intrinsic signals allows simultaneous recording of neuronal activity over large areas of cortex6–9. However, this technique cannot be considered to be noninvasive, and furthermore, its application is limited to the exposed cortical surface9,10. The progress of blood-oxygenation level-dependent functional magnetic resonance imaging11,12 raises hope that the functional architecture of the living brain can be visualized noninvasively, avoiding the limitations of the aforementioned techniques. Using the paramagnetic deoxyhemoglobin as an endogenous contrast agent11,12, BOLD-based functional images can be obtained in vivo (in contrast to the 2-deoxyglucose (2DG) technique5,13), do not require extrinsic contrast agents (in contrast to the positron emission technique14,15) and can access activation signals from the entire brain (in contrast to optical imaging6–9). Most importantly, the noninvasiveness of MRI ideally suits this technique for studying the human brain during cognitive and perceptual tasks16–21. Numerous BOLD studies during cognitive16, motor17 and perceptual18–21 tasks indicate good spatial correlation between neuronal and hemodynamic responses at a coarse scale (several millimeter to centimeter), and the BOLD signal pointspread is comparable to that of optical imaging21. The ability of BOLD fMRI to map the columnar architecture of the brain, however, is controversial, as the ultimate functional specificity of BOLD is undetermined. Because optical spectroscopy data predicts a ‘biphasic’ BOLD response following neuronal stimulation22,23 (with each BOLD phase potentially yielding different mapping 164
resolutions), it becomes imperative to determine the limits of the functional specificity that can be achieved with BOLD. The exact temporal kinetics of the BOLD responses in mammalian brains, however, remain vigorously debated (compare refs. 24–26 with refs. 27, 28); thus it remains to be seen whether the functional specificity of BOLD is sufficient to map the basic computational units of the brain’s functional architecture, namely, that of cortical columns.
RESULTS To resolve the question of whether and to what extent the columnar architecture of the brain can be labeled using the BOLDfMRI technique, we used ultra-high field magnets to obtain MR signals originating from individual orientation columns in cat visual cortex (area 18). Visual stimuli were optimized to drive orientation-selective, complex-type area 18 neurons29. In this study, area 18 was used because the distance between two isoorientation columns is greater in this area than in area 17 (ref. 30). Furthermore, area 18 on the lateral gyrus is essentially flat in the cat and can be covered by a single imaging slice. We carried out a total of ten semi-chronic experiments in ten hemispheres of five different animals. Unless otherwise mentioned, similar results were obtained in all ten experiments. Statistical data for all ten studies are given in parentheses. Figure 1a shows an anatomical MR image of cat visual cortex on the lateral gyrus. All activation maps were derived from a plane tangential to area 18 on the lateral gyrus (green box, Fig. 1a). Colored pixels indicating regions of increased BOLDsignal change (Fig. 1c; see Methods) reveal the pattern of cortical activation in response to a moving grating oriented at 45°. As indicated in this panel, robust and homogenous activities were observed in the lateral gyri of both hemispheres. The region of activity extended several millimeters in anterior–posterior and medial–lateral directions. In cat area 18, the average spacing between two neighboring iso-orientation columns is ∼1.2–1.4 mm (ref. 30). Therefore, the nominal in-plane resolution of 156 × 156 µm2 per pixel achieved in this study (see Methods) should have been sufficient to resolve individual orientation columns. As evident in Fig. 1c, however, a ‘columnar’ layout was not obtained. All four activation maps nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
a
b
expected to greatly enhance the functional specificity of fMRI. Such an improvement of functional specificity was achieved in our study (Fig. 1d). Here, only the ‘negative’ BOLD percent changes originating within the first two seconds after the stimulus onset were used to generate functional maps (see Methods). The colored pixels indicate regions of significant decrease in the MR signals following visual stimulation. In sharp contrast to the conventional d e c fMRI maps based on the positive BOLD-signal changes (Fig. 1c), the foci of the negative signal changes are confined to patchy clusters (Fig. 1d). In line with the iso-orientation columns in cat detected with 2-DG30 and optical imaging32,33 techniques, such semi-ellipsoidal and irregularly shaped clusters were broadly distributed over the approximated area 18 with an average periodicity of Fig. 1. Improvement of spatial specificity of BOLD using the initial negative signal changes. about 1.34 ± 0.23 mm. Note also that (a) Anatomical image of cat area 18 on the lateral gyrus (image size, 2 × 2 cm2). The green box indicates the areas defined by negative signal the position of the imaging slice used to obtain the activation maps displayed in this study. (b) The biphachanges were located largely in tissic MR signal time course following visual stimulation. Stimulus duration of 10 s is marked by the gray sue areas, excluding regions of large box ‘behind’ the time course. Scale bar (b), 10 s. (c) Pattern of increased BOLD activity in response to moving 45° gratings. The positive BOLD percent changes are marked with colors as indicated by the blood vessels such as that surroundcolor scale below. (d) Functional map for which only negative BOLD percent changes occurring within ing the sagittal sinus. Given the large difference in the first two seconds after stimulus onset were used. The color scale below indicates the negative percent changes. (e) The pattern of positive BOLD responses after the threshold for functional image con- absolute amplitude between the negstruction was raised to match the number of the activated pixels to that in panel (d). See text for details. ative and positive signal changes, it Scale bar (c–e), 1 mm. A, anterior; P, posterior. is conceivable that the differences in spatial pattern between the positive (Fig. 1c) and negative (Fig. 1d) maps could be simply due to the difficulty in equating signal-threshold levels. Therefore, as a control, we obtained in response to moving gratings of four different orientaraised the threshold for positive responses to match the numtions (0°, 45°, 90°, 135°) yielded homogeneous spatial distributions ber of activated pixels to that in the negative map (Fig. 1e). The that were hardly distinguishable (data not shown; see also ref. 31). resulting positive map largely reflects the pattern of surface vasThis result is consistent with optical spectroscopy data22,23, culature in visual cortex. suggesting that the stimulation of cortical neurons gives rise to Patterns of negative activity obtained from the same patch of a biphasic hemodynamic response of which only the early cortex while the animal viewed four different orientation stimuli increase of local deoxyhemoglobin (and hence a decrease in MR further corroborate functional significance of the negative BOLD signal) reflects increased neuronal activity and oxygen consignals (Fig. 2a–d). Analogous to 2-DG30 and optical imaging32,33, sumption22,23. Subsequent decrease of deoxyhemoglobin (and hence an increase of MR signal), which forms the basis for conwe show regions of high activity (large negative signals) as dark ventional BOLD11,12, is hypothesized to originate mainly from pixels. Each pattern of negative activity was highly specific to the respective stimulus orientation. To support this notion, outlines the widespread increase in blood flow, thus making it less suitof the orientation patches for 90° and 135° maps were overlaid able to discriminate electrically active from inactive columns. on the maps obtained for the respective orthogonal orientations In cat visual cortex, the time evolution of MR signals was indeed (Fig. 2a–d). biphasic (Fig. 1b). Following visual stimulation (as indicated by the It is clear from these panels that the patches for orthogonal gray box behind the time course), the MR signal decreased, reachorientations occupied cortical territories that were mostly coming a minimum of about –0.2% to –0.4% (–0.28 ± 0.1%, n = 10) plementary to each other. The complementarity between maps around 3 seconds (2.9 ± 0.7 s, n = 10) after the stimulus onset. The of orthogonal orientations was highly significant (linear correlasignal then reversed, yielding a maximum positive signal change of tion between 0° and 90° maps, r = −0.4, p < 10–6; between 45° and 1.0–2.0% (1.3 ± 0.4%, n = 10) approximately 8–10 seconds after stimulus onset (8.0 ± 1.3 s, n = 10). Biphasic BOLD responses fol135°, r = −0.55, p < 10–6; see Methods). Stimulus-selective responslowing visual stimulation were observed in all ten experiments at es based on negative BOLD signals were reflected at the columtwo different magnetic fields. nar scale (Fig. 2e and f); these panels present the signal time As the early negative signal changes are likely to reflect the courses obtained from 45° and 135° orientation columns (in green transient increase of local deoxyhemoglobin in parenchymal tisand in red, respectively; see Methods). MR signals in pixels repsue 22,23, their use in generation of a functional map can be resenting 45° columns (green trace) decreased transiently during nature neuroscience • volume 3 no 2 • february 2000
165
© 2000 Nature America Inc. • http://neurosci.nature.com
a
b
c
d
e
f
Signal change (%)
© 2000 Nature America Inc. • http://neurosci.nature.com
Negative BOLD activity
articles
Fig. 2. Representation of orthogonal orientations in complementary cortical domains. (a–d) Patterns of negative activity in response to four orientations (0°, 45°, 90°, 135°). Regions of negative signal changes during the first two seconds following visual stimulation are displayed as dark pixels. For visual inspection of the complementarity between the orthogonal orientation maps, the patches in panels (b) and (d) are outlined (in blue and red, respectively) and overlaid on the maps in panels (a) and (c), respectively. With few exceptions (marked by yellow arrowheads), the maps for orthogonal orientations are complementary to each other. Scale bar, 1 mm. (e, f) The signal time courses for 45° (green) and 135° (red) columns during the stimulation with 45° (c) and 135° (d) orientation stimuli. The stimulation duration of ten seconds is marked by the gray boxes behind the time courses. Scale bar (e, f), 10 s.
45° stimulation (Fig. 2e), whereas little or no such decrease was observed during 135° stimulation (Fig. 2f). Likewise, MR signals from 135° columns (red trace) decreased transiently in response to the 135° stimulus (Fig. 2f), but not to the complementary 45° stimulus (Fig. 2e). The difference between 45° and 135° columns in magnitude of the early negative signals during the 45° (Fig. 2e) and 135° (Fig. 2f) stimulation was statistically significant (p < 0.005 and p < 0.003, respectively; paired t-test). The positive BOLD signals (Fig. 2e and f), on the other hand, were much less suited to discriminate between 45° and 135° columns, as they yielded largely overlapping time courses for the two orthogonal stimuli. The differences in positive signals originating from the orthogonal columns were statistically insignificant (p = 0.19, paired t-test). To allow more direct comparison of the map quality, we also calculated the 45° and 135° maps obtained during the positive BOLD period (Fig. 3a and b). All functional maps depicted in Figs. 2 and 3 were acquired in the same fMRI studies, and images were processed with analogous methods (see Methods). In contrast 166
to the patchy, interdigitized columns of the negative maps, the domains of the positive BOLD responses were larger, with no apparent periodicity. The outlines of the 135° map from Fig. 3b were then overlaid on the 45° map (Fig. 3a). The regions of positive activity for the orthogonal orientations were mostly overlapping (linear correlation between the two maps, r = 0.69, p < 10–6). The results in Figs. 2 and 3 indicate, therefore, that although the amplitudes of the negative signals were far smaller than those of the positive signals, the stimulus-specific contrast of the negative signals was superior to that of the positive signals. Based on Fig. 2e and f, the stimulus-specific contrast of the negative signals was calculated to be about 6.5 times larger than that of the positive signals. The ultimate validation of the veracity of the iso-orientation columns based on negative BOLD changes would require simultaneous single-unit recording. Such simultaneous recording, however, would require placement of the recording electrodes in the iso-center of the magnetic bore, resulting in devastating magnetic field interferences. Furthermore, it would be almost impossible to change the electrode track or introduce new electrodes without repositioning the animal. Alternatively, the specificity of the negative BOLD signals at the columnar scale can be tested by comparing their detailed spatial pattern with that obtained by using more traditional brain-mapping techniques. A characteristic and invariant feature of the mammalian orientation system is the presence of ‘topological singularities’32–34, which are observed in many species using both multi-electrode34,35 and optical-imaging32,33,36–38 techniques. Therefore, to validate the functional specificity of the negative BOLD maps, we calculated the ‘composite-angle’ maps through vector summation of the underlying activation maps obtained for the four different orientations (see Methods; Fig. 4). In the composite map based on only the early negative BOLD signals (Fig. 4a), the colors (preferred orientations) change smoothly, forming a map of orientation selectivity. The continuity of orientation preferences is interrupted only at the singular points (termed orientation pinwheels) where the domains for all orientations converge, as observed using multielectrode34,35 and optical imaging32,33,36–38 techniques. Each orientation is represented only once around such a pinwheel; therefore each of these topological singularities takes on one of two rotational chiralities, namely clockwise or counter-clockwise pinwheels. Two such pinwheels are enlarged (Fig. 4a, right). The pinwheel density and the ratio between clockwise and counter-clockwise singularities found in negative BOLD composite maps were in excellent agreement with those obtained with optical imaging. We found a pinwheel density of 1.46 ± 0.17 pinwheels per mm2 (n = 4); in comparison, optical imaging studies 32,37 yielded average pinwheel densities of 1.2–1.95 pinwheels per mm2. Likewise, the ratio of clockwise to counterclockwise pinwheels was found to be roughly 1:1 in both negative-BOLD (1:0.89, n = 4) and optical imaging 37 (1:0.9) data. Although the above data are in excellent agreement with data from multi-electrode34,35 and optical imaging studies32,33,36–38, it is theoretically possible but unlikely that such topological singularities could arise from a randomly distributed pattern of activity39. Therefore, as a control, composite maps based on signals obtained before stimulus onset (Fig. 4b) and those during the delayed positive BOLD changes (Fig. 4c) were also calculated. All steps for composite-map construction were performed exactly as for Fig. 4a (see Methods). Unlike the composite map based on negative BOLD signals (Fig. 4a), the maps based on nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 3. Representation of orthogonal orientations of positive BOLD maps. (a, b) Functional maps based on positive signal changes obtained with 45° and 135° stimuli, respectively. High positive signals are represented by dark pixels (see text). Maps in Figs. 2 and 3 were obtained from the same experiment. The domains of high activity in 135° map (b) are outlined and overlaid on the 45° map (a). Most of the active domains in both maps overlapped extensively, except a few areas as marked with green arrowheads. Scale bar, 1 mm.
a
b
© 2000 Nature America Inc. • http://neurosci.nature.com
Positive BOLD activity
control (Fig. 4b) or delayed positive BOLD signals (Fig. 4c) displayed none of the characteristic features of the mammalian angle maps.
DISCUSSION Our results indicate that the functional specificity of BOLD at the columnar scale depends highly on the temporal dynamics of the underlying signals. If the early negative signals are used, functional maps at columnar resolution can be obtained without differential imaging (see below). The delayed positive BOLD changes, on the other hand, clearly indicated the pattern of the overall activation per se in the visual cortex, but were less suited to discriminate between active and inactive columns, as they were more diffuse21–23 and less specific to the individual stimulus properties. It is, of course, conceivable that, in principle, even such diffuse positive BOLD signals might yield columnar patterns of activity if maps of orthogonal conditions were subtracted from each other. Such differential imaging had been suggested for analyzing optical imaging40 and conventional (positive) BOLD data41. Although the use of a differential method for opticalimaging data might be defendable given the well established verification of intrinsic signals with extensive single-unit studies37,38,
a
b
c
nature neuroscience • volume 3 no 2 • february 2000
the use of a differential method for BOLD fMRI data poses severe difficulties. In differential imaging, one activation map (for example, of the left eye) is subtracted from the other activation map (the right eye), with the assumption that the two maps yield complementary activation patterns. If this assumption is true—such as between left- and right-eye domains—then the result of the subtraction is tautological, because it was known in advance. However, if the assumption is not true or simply unknown, as for most receptive-field properties, then the subtraction method will probably give the wrong answer. Without direct validation of BOLD using simultaneous single-unit recordings, the applicability of the differential method for BOLD data remains questionable. The main significance of the ‘negative BOLD’ imaging is therefore that a columnar pattern of high functional specificity can be obtained directly, without the need for such differential methods. As the T2 and T2*-weighted BOLD contrast predominantly originates from the regional changes in paramagnetic deoxyhemoglobin concentration10,11,42, the early decrease of BOLD signals can most likely be attributed to the regional increase of deoxyhemoglobin following neuronal stimulation. Although alternative explanations exist43,44, the most parsimonious explanation for such transient BOLD signal decrease is caused by elevated oxygen consumption44 in the active orientation column without a commensurate increase in blood flow22,23. Recently, similar decreases in BOLD signals have been observed in the visual cortices of awake human24–26,45 and anesthetized nonhuman primates46 during perceptual Fig. 4. fMRI-based composite angle maps. (a) The composite angle map obtained through pixel-by-pixel vector addition of the four single iso-orientation maps based on negative signal changes. The color key next to (a) was used for color coding the resulting orientation preferences. Overall continuity of the orientation preferences is interrupted at the orientation pinwheels where the cortical columns for different orientations are circularly arranged. The white and black circles in (a) depict clockwise and counterclockwise pinwheels, respectively. Two of such pinwheels are enlarged right (a). Scale bar for the enlarged pinwheels, 200 µm. As a control, the composite maps based on MR signals obtained before stimulus onset (b) and during positive BOLD signals (c) are also displayed. Maps in (b) and (c) were obtained from the same cortical region as in (a). The control maps are devoid of topological structures characteristic of genuine composite angle maps. Scale bar (a–c), 1 mm. A, anterior; P, posterior; M, medial; L, lateral. 167
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
tasks, indicating that the capability of BOLD-fMRI to label functional columns in vivo should also be applicable in humans and monkeys. We conclude from our study that noninvasive fMRI of brain functions can be performed at the columnar levels. Thus it now becomes possible to study the precise three-dimensional layouts of columnar structures in mature and developing brains, regardless of their location in the brain.
© 2000 Nature America Inc. • http://neurosci.nature.com
METHODS Animal preparation. All animal experiments were performed with institutional approval. Animals were initially anesthetized with a ketamine (10–25 mg per kg, i.v.) and xylazine (2.5 mg per kg) cocktail. The animals were intubated and artificially ventilated (25–35 strokes per min, 15–30 ml per stroke) under isoflurane anesthesia (0.8–1.5%) in a N2O:O2 mixture of 70:30 throughout the experiment. The animal’s eyes were refracted and corrective contact lenses used if necessary. The animal was placed in a cradle and restrained in normal postural position using a custom-designed stereotaxic frame. Endtidal CO2, respiration rate and rectal temperature were monitored throughout the experiment. Following the three-to-five-hour MR experiments, gas anesthesia was discontinued, and animals were kept on the respirator until they could breathe independently. The animals were observed for 0.5–2.0 h before being returned to their littermates. Stimulation protocol. Animals were stimulated binocularly. Visual stimuli consisted of high-contrast square-wave moving gratings (0.15 cycles per degree, 2 cycles per s) of four different orientations (0°, 45°, 90°, 135°), optimized to elicit responses from neurons in area 18 of the cat visual cortex29. During the resting period, a stationary grating pattern of identical spatial frequency and orientation was presented. A video projector (Resonance Technology, Northridge, California; resolution, 640 × 480 pixels) was used to project the visual stimuli onto a screen positioned 15 cm from the animal’s eyes. The screen covered about 37° of the animal’s visual field. MR methods. After placing the animal in a cradle, we placed a small surface coil (diameter, 1.2 cm) on top of the animal’s head corresponding to the Horsley-Clark A3. All MR experiments were performed on an Oxford (4.7 T, 40 cm in diameter; Oxford, UK) or Magnex (9.4 T, 31 cm in diameter; Abingdon, UK) horizontal MRI scanner equipped with a magnetic field gradient of 15 or 30 gauss per cm, respectively. Data obtained at two magnetic field strengths were analyzed separately. The amplitude and phase of the biphasic time courses obtained at the two field strengths however, were averaged together, as they yielded comparable results. BOLD measurements on a single image slice was made using gradient-echo echo-planar imaging (EPI). The imaging slice was positioned ∼500 µm below the pia to avoid superficial draining vessels. The MR imaging parameters were data matrix, 64 × 64; single-shot (4.7 T) or 2-shot (9.4 T) EPI; FOV, 2 cm × 2 cm; slice thickness, 2 mm; TE, 31 ms (4.7 T) or 12 (9.4 T) ms; TR, 0.5 s. A total of 160 images were acquired during each epoch (60 images before stimulation, 20 images during stimulation and 80 images after stimulation). Images with a 64 × 64 matrix were zero-filled to a 128 × 128 matrix, resulting in nominal in-plane resolution of 156 × 156 µm2 per pixel. Images obtained for the same orientations within a single fMRI session were averaged for signal-to-noise ratio improvement (usually five to ten epochs). Functional image construction. To determine the existence of BOLD activity per se, the MR signals were first cross-correlated with the stimulation protocol47. The cross-correlation coefficient threshold was set at > 98% confidence level. The percent-change maps within the negative and positive portions of BOLD time course were averaged into respective time-binned maps (‘positive’ and ‘negative’ map, respectively). For the map of the negative response, individual pixels showing negative percent change ≥ 0.5–1.0 s.d. from the mean baseline percent change were taken as statistically significant. Because we used clustered pixel analysis with a cluster size of 4 pixels, the nominal p-value for our threshold was p < 0.2 (ref. 47). The same threshold was used for calculating the four different 168
iso-orientation maps for each experiment. For the positive response (Fig. 1c), the threshold was raised in proportion to ratio of the maximum positive to the minimum negative BOLD response for each animal (approximately fivefold). For the negative and positive BOLD maps depicted in Fig. 1, no subtraction or image filtering method was applied. Analysis of iso-orientation maps. Similar image-processing methods were used to construct the iso-orientation maps based on negative or positive BOLD data. Analogous to the standard analysis of optical-imaging data32,33,37, responses to the four different orientations were obtained by dividing each ‘single orientation map’ (raw percent-change maps) by the normalized sum of four orientations (‘cocktail blank’). For displaying the maps, the dynamic range of the negative (Fig. 2a–d) and positive (Fig. 3a and b) maps were ‘clipped’ at the upper and lower three percent of the distribution and linearly mapped on an eight-bit gray scale. In both the negative and positive maps, high-frequency noise was removed using a 3 × 3 pixel Gaussian kernel. The complementarity of the orthogonal maps was tested by calculating the linear correlation coefficient between the two maps48. Correlation coefficient p-values were calculated using standard algorithms48. For the MR time courses in Fig. 2, the ROI for the 45° columns was selected on the basis of negative responses during only the 45° stimulation. The same ROI was then used to plot the time course of those pixels during the 135° stimulation. Likewise, the ROI for the 135° columns was selected on the basis of negative responses during only the 135° stimulation. This ROI was then used to plot the time course of the pixels during the 45° stimulation. The differences in positive signal contrasts during the 45° and 135° stimulations were therefore independent of the initial pixel selection process. Analysis of angle maps. Composite angle maps for the negative BOLD changes (Fig. 4a) were obtained through a pixel-by-pixel vector addition of the four iso-orientation maps (see above) with the negative percent changes as vector amplitudes and the respective stimulus orientations as vector angles7,32,33. Such composite angle maps were obtained for four different experiments that yielded the best contrast-to-noise ratio. The resulting angle at each pixel was color-coded using a circular color table. The positions and densities of the pinwheel centers were detected by calculating the spatial gradients of the composite angle map32,37 and checked visually. As a control, ‘composite’ maps were also calculated based on MR signals obtained before visual stimulation (Fig. 4b) and those obtained during delayed positive BOLD responses (Fig. 4c; 8–20 s after stimulus onset). For the sake of consistency, the composite maps in Fig. 4a–c were generated using identical methods for the region of interest, threshold and vector-summation.
ACKNOWLEDGEMENTS We thank K. Ugurbil for continuing support of our project and S. Ogawa, A. Grinvald, R.B. Tootell, J. Ashe and A. P. Georgopoulos for suggestions and comments. H. Merkle and J. Strupp provided support in hardware and software. This work was supported by the NIH (NS38295, MH57180, NS10930, RR08079), the Minnesota Medical Foundation and the Keck Foundation.
RECEIVED 20 AUGUST; ACCEPTED 29 NOVEMBER 1999 1. Brodmann, K. Vergleichende Lokalisationslehre der Grosshirnrinde (Johann Ambrosius Barth, Leipzig, 1909). 2. Hubel, D. H. & Wiesel, T. N. Receptve field, binocular interactions and functional architecture in the cat’s visual cortex. J. Physiol. (Lond.) 160, 106–154 (1962). 3. LeVay, S., Stryker, M. P. & Shatz, C. J. Ocular dominance columns and their development in layer IV of cat’s visual cortex. J. Comp. Neurol. 179, 223–244 (1978). 4. LeVay, S. & Nelson, S. B. Vision and Visual Dysfunction 266–315 (Macmillan, Houndsmill, 1991). 5. Sokoloff, L. et al. The 14C-deoxyglucose method for the measurement of local cerebral glucose utilization: theory, procedure, and normal values in the conscious and anesthetized albino rat. J. Neurochem. 28, 897–916 (1977).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
6. Grinvald, A., Lieke, E., Frostig, R. D., Gilbert, C. D. & Wiesel, T. N. Functional architecture of cortex revealed by optical imaging of intrinsic signals. Nature 324, 361–364 (1986). 7. Ts’o, D. Y., Frostig, R. D., Lieke, E. E. & Grinvald, A. Functional organization of primate visual cortex revealed by high resolution optical imaging. Science 249, 417–420 (1990). 8. Frostig, R. D., Lieke, E. E., Ts’o, D. Y. & Grinvald, A. Cortical functional architecture and local coupling between neuronal activity and the microcirculation revealed by in vivo high-resolution optical imaging of intrinsic signals. Proc. Natl. Acad. Sci. USA 87, 6082–6086 (1990). 9. Bonhoeffer, T. & Grinvald, A. The layout of iso-orientation domains in area 18 of cat visual cortex: optical imaging reveals a pinwheel-like organization. J. Neurosci. 13, 4157–4180 (1993). 10. Stetter, M. & Obemayer K. Simulation of scanning laser technique for optical imaging of blood-related intrinsic signals. J. Opt. Soc. Am. A 16, 58–70 (1999). 11. Ogawa, S. et al. Intrinsic signal changes accompanying sensory stimulation: functional brain mapping with magnetic resonance imaging. Proc. Natl. Acad. Sci. USA 89, 5951–5955 (1992). 12. Kwong, K. K. et al. Dynamic magnetic resonance imaging of human brain activity during primary sensory stimulation. Proc. Natl. Acad. Sci. USA 89, 5675–5679 (1992). 13. Loewel, S. & Singer, W. Tangential intracortical pathways and the development of iso-orientation bands in cat striate cortex. Dev. Brain Res. 56, 99–115 (1990). 14. Fox, P. T. & Raichle, M. E. Focal physiological uncoupling of cerebral blood flow and oxidative metabolism during somatosensory stimulation in human subjects. Proc. Natl. Acad. Sci. USA 83, 1140–1144 (1986). 15. Posner, M. I. & Raichle, M. E. Images of Mind (Freeman, New York, 1994). 16. Wagner, A. D. et al. Building memories: remembering and forgetting of verbal experiences as predicted by brain activity. Science 281, 1188–1191 (1998). 17. Kim, S.-G. et al. Functional magnetic resonance imaging of motor cortex: hemispheric asymmetry and handedness. Science 261, 615–617 (1993). 18. DeYoe, E. A. et al. Mapping striate and extrastriate visual areas in human cerebral cortex. Proc. Natl. Acad. Sci. USA 93, 2382–2386 (1996). 19. Sereno, M. I. et al. Borders of multiple visual areas in humans revealed by functional magnetic resonance imaging. Science 268, 889–893 (1995). 20. Tootell, R. B. et al. Functional analysis of V3A and related areas in monkey visual cortex. J. Neurosci. 17, 7070–7078 (1997). 21. Engel, A. S., Glover, G. H. & Wandell, B. A. Retinotopic organization in human visual cortex and the spatial precision of functional MRI. Cereb. Cortex 7, 181–192 (1997). 22. Malonek, D. & Grinvald, A. Interactions between electrical activity and cortical microcirculation revealed by imaging spectroscopy: Implication for functional brain mapping. Science 272, 551–554 (1996). 23. Malonek, D. et al. Vascular imprints of neuronal activity: relationships between the dynamics of cortical blood flow, oxygenation, and volume changes following sensory stimulation. Proc. Natl. Acad. Sci. USA 94, 14826–14831 (1997). 24. Ernst, T. & Henning, J. Observation of a fast response in functional MR. Magn. Reson. Med. 32, 146–149 (1994). 25. Menon, R. S. et al. BOLD based functional MRI at 4 Tesla includes a capillary bed contribution: Echo planar imaging correlates with previous optical imaging using intrinsic signals. Magn. Reson. Med. 33, 453–459 (1995). 26. Hu, X., Le, T. H. & Ugurbil, K. Evaluation of the early response in fMRI in individual subjects using short stimulus duration. Magn. Reson. Med. 37, 877–884 (1997).
nature neuroscience • volume 3 no 2 • february 2000
27. Marota, J. J. A. et al. Investigation of the early response to rat forepaw stimulation. Magn. Reson. Med. 41, 247–252 (1999). 28. Silva, A. C., Lee, S.-P., Iadecola, C. & Kim, S.-G. Early characteristics of CBF and deoxyhemoglobin changes during somatosensory stimulation. J. Cereb. Blood Flow Metab. 20, 201–206 (2000). 29. Movshon, J. A., Thompson, I. D. & Tolhurst, D. J. Spatial and temporal contrast sensitivity of neurons in areas 17 and 18 of the cat’s visual cortex. J. Physiol. (Lond.) 283, 101–120 (1978). 30. Loewel, S., Freeman, B. & Singer, W. Topographic organization of the orientation column system in large, flat-mounts of the cat visual cortex: A 2deoxyglucose study. J. Comp. Neurol. 255, 401–415 (1987). 31. Jezzard, P., Rauschecker, J. P. & Malonek, D. An in vivo model for functional MRI in cat visual cortex. Magn. Reson. Med. 38, 699–705 (1997). 32. Bonhoeffer, T. & Grinvald, A. Iso-orientation domains in cat visual cortex are arranged in pinwheel-like pattern. Nature 353, 429–432 (1991). 33. Kim, D.-S. & Bonhoeffer, T. Reverse occlusion leads to a precise restoration of orientation preference maps in visual cortex. Nature 370, 370–372 (1994). 34. Swindale, N. W, Matsubara, J. A. & Cynader, M. S. Surface organization of orientation and direction selectivity in cat area 18. J. Neurosci. 7, 1414–1427 (1987). 35. Diao, Y. C., Jia, W. G., Swindale, N. V. & Cynader, M. S. Functional organization of the cortical 17 per 18 border region in the cat. Exp. Brain Res. 79, 271–282 (1990). 36. Maldonado, P. E., Goedecke, I., Gray, C. M. & Bonhoeffer, T. Orientation selectivity in pinwheel centers in cat visual cortex. Science 276, 1551–1555 (1997). 37. Shmuel, A. & Grinvald, A. Functional organization for direction of motion and its relationship to orientation maps in cat area 18. J. Neurosci. 16, 6945–6964 (1996). 38. Crair, M. C., Gillespie, D. C. & Stryker, M. P. The role of visual experience in the development of columns in cat visual cortex. Science 279, 566–570 (1998). 39. Rojer, A. S. & Schwartz, E. L. Cat and monkey cortical columnar patterns modeled by bandpass-filtered 2D white noise. Biol. Cybern. 62, 381–391 (1990). 40. Blasdel, G. G. Differential imaging of ocular dominance and orientation selectivity in monkey striate cortex. J. Neurosci. 12, 3115–3138 (1992). 41. Menon, R. S., Ogawa, S. Strupp, J. P. & Ugurbil, K. Ocular dominance in human V1 demonstrated by functional magnetic resonance imaging. J. Neurophysiol. 77, 2780–2787 (1997). 42. Ogawa, S., Menon, R. S., Kim, S.-G. & Ugurbil, K. On the characterizatics of functional magnetic resonance imaging of the brain. Annu. Rev. Biophys. Biomol. Struct. 27, 447–474 (1998). 43. Janz, C., Speck, O. & Henning, J. Time-resolved measurements of brain activation after a short visual stimulus: new results on the physiological mechanisms of the cortical response. NMR Biomed. 10, 222–229 (1997). 44. Vanzetta, I. & Grinvald, A. Increased cortical oxidative metabolism due to sensory stimulation: implications for functional brain imaging. Science 286, 1555–1558 (1999). 45. Yacoub, E. & Hu, X. Detection of the early negative response in fMRI at 1.5 Tesla. Magn. Reson. Med. 41, 1088–1092 (1999). 46. Logothetis, N. K., Guggenberger, H., Peled, S. & Pauls, J. Functional imaging of the monkey brain. Nat. Neurosci. 2, 555–562 (1999). 47. Forman, S. D. et al. Improved assessment of significant activation in functional magnetic resonance imaging (fMRI): use of a cluster-size threshold. Magn. Reson. Med. 33, 636–647 (1995). 48. Press, W. H., Teukolsky, S. A., Vetterling, W. T. & Flannery, B.P. Numerical Recipes in C (Cambridge, UK, 1992).
169
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Dynamics of perceptual oscillations in form vision Hugh R. Wilson1, Boris Krupa1 and Frances Wilkinson2 1
Visual Science Center, University of Chicago, 939 E. 57th Street, Chicago, Illinois 60637, USA
2
Department of Psychology, 1205 Docteur Penfield Avenue, McGill University, Montreal, Quebec, H3A 1B1, Canada
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to H.R.W. (
[email protected])
Certain periodic dot patterns (Marroquin patterns) generate a percept of dynamically oscillating circles, and analogous effects were explored by op artists in the 1960s. Here we show psychophysically that circles are perceived in these patterns only around specific points that are quantitatively predicted by a neural model of configural units hypothesized to reside in cortical area V4. Circles superimposed on the pattern mask perception of illusory circles. A neural model of lateral inhibitory interactions among V4 configural units showing spike-frequency adaptation quantitatively accounts for the human data. The model is consistent with ideas on the neural basis of attention in V4, and it suggests that attention may be biased via neuromodulation of slow hyperpolarizing potentials in cortical neurons.
Certain static patterns generate dynamic visual percepts, an effect on which op artists capitalized frequently during the 1960s1,2. One salient example is the pattern (Fig. 1a) created in 1976 by Marroquin3. This pattern is produced by superimposing three copies of a square dot grid, each copy being rotated by 60° relative to the others. This static pattern generates a percept of circular shapes that appear and vanish at various locations in an oscillatory fashion. Vision scientists have characterized this and related oscillating patterns as products of dynamic grouping4,5. Such explanations, however, raise questions concerning the nature of this grouping and the underlying dynamical processes producing oscillations. Here we apply psychophysical techniques to measure the frequency and duration of circle visibility throughout the Marroquin pattern, and we demonstrate that a plausible neural model can quantitatively account for the data. In searching for a possible neural basis for the oscillating circles in the Marroquin pattern, a connection with the perception of circular structure in Glass patterns6,7 suggested itself. (See refs. 8, 9 for examples of Glass patterns.) Circular structure in these random-dot patterns is considerably more salient than radial, hyperbolic or translational structure8,9. The visual system extracts concentric structure from Glass patterns by linear pooling of quasi-concentric orientations, and a neural model derived from these observations provides a quantitative explanation of the data8. Comparison with primate single-unit physiology10–12 suggests that such concentric units might arise in V4, an intermediate area in the ventral form-vision system13,14. Evidence for units optimized for analysis of quasi-concentric structure in human V4 is supported by converging evidence from fMRI (James et al., Invest. Ophthalmol. Vis. Sci. 40, S819, Abstr. 4313, 1999), eventrelated potentials recorded directly from the human cortical surface15 and studies of a patient with unilateral V4 damage (Mazer et al., Soc. Neurosci. Abstr. 25, 212.14, 1999). Neural simulations have demonstrated that model V4 units can provide a population code for the location, shape and bilateral symmetry of human heads16. For example, model V4 concentric units can 170
extract the center and mean radius of a face transparently added to a house (Fig. 1b), a stimulus that has been used to provide evidence for object-based attention17. Thus, V4 concentric units may be important in face and other ellipsoidal object analysis as well as in selective attention. Selective attention effects are evident in V4 at the single neuron level18–21 and are believed to result from inhibitory competition in parallel networks22. This suggested that the Marroquin illusion might arise from competitive interactions among V4 concentric units, and that the illusion might therefore provide further insight into the mechanisms of selective attention in V4. The results reported here confirm that inhibitory interactions among model V4 concentric units account quantitatively for visibility of Marroquin circles throughout the pattern. The resultant neural network may therefore form a basis for spatial or object based selective attention, with neuromodulation of spikefrequency adaptation providing a mechanism for top-down biasing of attentional effects.
RESULTS Psychophysics To understand the dynamics underlying the Marroquin illusion, we first asked whether circles were more likely to appear at some locations than at others. The visibility of circles centered at different points in the Marroquin pattern was quantified using a procedure analogous to that generally used in binocular rivalry measurements23. In each experiment, subjects fixated a red dot at a designated position within the Marroquin pattern and depressed a button whenever an illusory circle was perceived to be centered on that dot (see Methods). Because of the hexagonal symmetry of these patterns, measurements were restricted to ten dot positions within one sextant of the pattern. Visibility was defined as the fraction of a two-minute viewing period during which an illusory circle of specified diameter (line in Fig. 1a) was perceived to surround the designated center dot. Data for one subject are plotted at all ten positions for runs on three different days (Fig. 2a). Although data at different positions were collected in pseudonature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
a
b
Fig. 1. Patterns generating percepts of circular or ellipsoidal structure. (a) Marroquin pattern3 produced by superimposing three square grids of dots, each rotated by 60° relative to the others. In experiments, dots were presented against a gray background of mean luminance 50.5 cd per m2. While subjects fixate this pattern, illusory circles appear and vanish centered at various locations throughout the pattern. Although illusory circles of several different diameters are sometimes seen, with the dot separations and viewing distances used in our experiments, only illusory circles of one size were apparent (diameter indicated by horizontal line in lower right). (b) Simulated response of model V4 concentric units to a transparent face/house image of the type used in a study of object-based attention17. Processing of the face alone produced a maximum model response at the point indicated by the upper black circle. The mean radius of the stimulus was encoded by the maximum model response and corresponded to the distance indicated by the arrow. The model population response also encoded the stimulus as vertically elongated16. Superposition of the house onto the face only shifted the maximum V4 model response to the lower black circle but left both the estimated radius and axis of elongation essentially unchanged. Model V4 concentric units only responded to the face shape and thus are capable of extracting ellipsoidal object boundaries from complex images.
(Fig. 3a). These masking circles were centered at varying distances from the illusory center circle in different experiments. Both large circles (diameter 1.80°) and smaller circles (diameter 0.90°) produced significant reductions in the visibility of the illusory circle centered about position 1 (Fig. 3b). Significantly, masking data from both circle sizes fell off as the same function F of increasing radius R from position 1: F(R) = 1 — A exp (— R5/σ5)
random order on different days, performance was highly reproducible from day to day. Results averaged over three days of experiments for each of four subjects show a similar pattern (Fig. 2b). In comparing subjects, visibilities were normalized relative to that at position 1. (Absolute visibilities are listed in Table 1.) Although there was some variability among subjects, illusory-circle visibility was high for all subjects at positions 1, 7 and 10, whereas visibility was low at positions 5 and 8. One-way ANOVA showed a significant effect of position (F9,110 = 8.42, p < 0.0001). A post-hoc Fischer’s PLSD showed significant differences between each of positions 1, 7 and 10 and positions 5 and 8 at p < 0.0001.) Clearly, therefore, Marroquin patterns generate illusory circles preferentially surrounding particular ‘hot spots’ for all subjects, whereas circles are rarely perceived around other ‘cold spots’. Mean durations of illusory circle visibility are indicated for position 1 (the center of the pattern) in Table 1. Two subjects (FW and HRW) showed mean durations in the 2–3.5 s range, similar to binocular rivalry23,24, and both produced standard deviations comparable to the mean. The remaining two subjects had considerably longer mean visibilities. As the Marroquin oscillations are suggestive of instabilities in a competitive network, we wondered whether pattern masking might be effective in altering the mean visibility of illusory circles. To test this, further data were gathered at position 1 with a superimposed mask comprising four surrounding gray circles nature neuroscience • volume 3 no 2 • february 2000
(1) Only the amplitude A increased with increasing circle diameter, and s = 1.97° for both diameters. This suggests lateral inhibitory interactions among units optimized to extract quasicircular structure from stimuli. To test this idea further, the circular masks were replaced with four parallel vertical lines having the same separations as the circle diameter and the same total length as the circle circumferences. These lines produced almost no masking of illusory circle visibility (Fig. 3b). This provides further evidence that Marroquin patterns evoke lateral inhibition among units selective for concentric structure. Neural model The Marroquin oscillations can be explained by extending a neural model developed to account for the visibility of concentric structure in Glass patterns8. This model uses a sequence of oriented filtering, full-wave rectification and orthogonal secondstage oriented filtering (Fig. 5) to extract local curvature information from the stimulus25,26. There is direct psychophysical evidence that the final stage incorporates linear concentric pooling of curvature information8,9. Responses of such model units agree with a subset of neurons recorded in V4 in several studies10–12, and we will therefore refer to them as model V4 concentric units. Processing the Marroquin stimulus by an array of these units produced a response showing strong activation of model V4 units by certain pattern locations, but little or no activation by other locations (Fig. 4a). The three ‘hot spots’ and two ‘cold spots’ from the psychophysical data are marked, demonstrating qualitative agreement of the model responses with the data. A quantitative comparison among all ten positions demonstrates that the model responses agree well with relative visibilities averaged across subjects (Fig. 2c). Thus, the V4 concentric model accurately predicts relative visibilities of illusory circles at different locations throughout the Marroquin pattern. 171
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
Visibility
FW #1 FW #2 FW #3
Position
Relative visibility
Designating excitatory and inhibitory neuron spike rates by E and I, and the AHP current by H, a suitable set of equations to describe competitive interactions within a two-dimensional array of model V4 concentric cells is
c
τE
Position Mean data V4 model
Position
The oscillations of illusory circles in the Marroquin pattern must now be explained. The psychophysical masking data provide evidence for lateral inhibitory interactions that decline with the distance between concentric units, and this suggests the existence of a spatially regional winner-take-all (WTA) network among V4 concentric units. WTA networks in general, however, cannot generate oscillations unless the winners adapt or fatigue with time27. Here a property of virtually all neocortical excitatory (but not inhibitory) neurons in humans and other mammals suggests itself, namely, spike-frequency adaptation28–30. When stimulated by a constant-current input, neocortical excitatory neurons initiate firing at a high rate that typically drops by a factor of about 3.0 within a few hundred ms. This spike-frequency adaptation is mediated by a slow Ca2+-mediated K+ afterhyperpolarizing current (AHP). Inclusion of spike-frequency adaptation in a regional WTA network of model V4 concentric units produces a quantitative account of Marroquin pattern oscillations. 172
2
dEn 100 P+ = —En + 2 2 dt (10 + Hn) + P+
where P = SMarroquin —0.6n=kΣ Ik exp (— Rnk5/σ5)
Relative visibility or model response
© 2000 Nature America Inc. • http://neurosci.nature.com
b
Fig. 2. Visibility of illusory circles centered at ten different points in the Marroquin pattern. Because of hexagonal symmetry, these points were all chosen from one sextant of the pattern. Position 1 was the center of the pattern, and successively higher numbered points progressed outward toward the upper left. (a) Visibility (fraction of time an illusory circle was seen during a two-minute run) is plotted for all positions from three different days of experiments on FW. Despite pseudorandom ordering of data collection from day to day, a high degree of repeatability is evident. (b) Mean data for all four subjects are plotted normalized to the relative visibility at position 1. (Absolute visibilities are listed in Table 1.) Illusory circles were highly visible at positions 1, 7 and 10 for all subjects, whereas circles were seldom visible around positions 5 and 8. These five positions have been marked (Fig. 4a). This dependence of illusory circle visibility was highly statistically significant (see text). (c) V4 model predictions of visibility variations across positions are compared with data averaged across all subjects.
τI
dIn = —In + En dt
τH
dHn = —Hn + gEn dt
(2) The first equation here indicates that the excitatory firing rates follow a Naka-Rushton31 function of the net postsynaptic input P produced by stimulus SMarroquin, extracted from the Marroquin pattern by the model V4 circuit (Fig. 5a) minus network inhibition. Naka-Rushton functions provide good fits to firing rates of visual cortical neurons32,33. Each excitatory neuron En activates an inhibitory neuron In, which in turn provides subtractive inhibition to a range of neighboring E neurons (excluding En) using the connectivity function of relative distance Rnk derived from equation (1). Finally, adapting effects of the AHP current are simulated by an increase in the semi-saturation constant of the NakaRushton function mediated by Hn, a formulation that provides a reasonable approximation to cortical neuron adaptation27. In general, g = 2.9 (but it is assumed to be under neuromodulatory control; see Discussion), and the time constants were assigned the plausible values of τE = 15 ms, τI = 8 ms and τH = 400 ms. These constants reflect the faster spiking of I than of E neurons28, and τH falls within the range reported for AHP currents in human cortical neurons30,34. The temporal response from a model E neuron at position 1 of the Marroquin pattern shows the effects of spike-frequency adaptation in the rapid drop of spike rate to about one-third of the initial transient rate (Fig. 6a). As this neuron continues to fatigue further during its firing plateau, the effects of time-varying inhibitory inputs become evident. Ultimately, inhibition terminates spiking in this neuron, and neighboring neurons become active. Repeated simulations of the two-minute duration of our experiments with slightly different initial conditions produced the model responses summarized in Table 1. Similar to FW and HRW, the model predicted a visibility at position 1 of 0.62 and a mean visibility duration of 2.24 ± 1.93 s. Durations for both the model and human subjects were plotted in a histogram and fitnature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
b
Relative visibility
a
© 2000 Nature America Inc. • http://neurosci.nature.com
1.8° circle 0.9° circle lines
Mask displacement
Fig. 3. Masking of illusory circle visibility. (a) The masking stimulus comprised four circular contours superimposed on the Marroquin pattern. These masking circles were always spaced at equal distances from position 1, with distance being varied from experiment to experiment. As shown by mean data for four subjects (b), the masking circles greatly reduced the relative visibility of illusory circles centered on position 1, with larger effects being produced by larger diameter masking circles. Data for both circle sizes were well fit by the function in equation (1), with only amplitude A depending on size. For comparison, four vertical parallel lines with the same total length as the masking circle circumferences and spaced apart by a distance equal to the circle diameters produced almost no noticeable masking. These data thus reflect a form of pattern-specific masking rather than simple contour interactions per se.
ted with a gamma distribution function (Fig. 6b and c). The model and subjects both show comparably good fits to the gamma distribution (parameters summarized in Table 1). To illustrate the overall spatial percept implied by the model, neural responses 30 seconds into one simulation were convolved with the activating input extracted from the Marroquin pattern, which produced a circular configuration resembling the percept (Fig. 4b). As the model responses were sufficiently complex to suggest chaos, further simulations were conducted to compute the maximum Lyapunov exponent λ using standard techniques27. The extreme sensitivity to initial conditions of a chaotic system is manifested by a positive λ. We found that λ = –0.10/ms, so the neural model is not chaotic but rather represents a highly complex, asymptotically stable limit cycle oscillation. Rather than representing a simple alternation between two states as in binocular rivalry, this oscillation cycles through a very large ensemble of states before repeating.
DISCUSSION
radial gratings than by conventional sinusoidal gratings, although these studies did not test for the possibility of competitive interactions. The complex oscillations in this regional winner-take-all network are driven by spike-frequency adaptation in excitatory neurons, which is known to be caused by AHP currents 28–30 . Physiological studies of excitatory neurons from human neocortex have shown that AHP currents are modulated by histamine, acetylcholine, norepinephrine and serotonin, all of which reduce the magnitude of spike-frequency adaptation34. Effects of such neuromodulation in the model V4 competitive network can be incorporated simply by reducing the parameter g in equation (2). Simulations have shown that a 14% reduction to g = 2.5 causes the model to produce a 0.92 visibility as demonstrated by subject EL (Table 1). This provides a plausible explanation for individual differences in our study. As discussed elsewhere8,9, the filter–rectify–filter sequence at the earlier stages of the model is incorporated into many models for texture segregation. The unique aspect of our model is the final concentric, linear summation stage, which was derived from psychophysics8. To date, proponents of other approaches to texture
The foregoing analysis demonstrates that the Marroquin illusion can be explained quantitatively by inhibitory interactions giving rise to a regional winner-take-all computation. Input to this network is Table 1: Summary of data for four subjects and V4 model simulation. provided by model units that explain Subject Visibility Duration (s) Gamma n Gamma λ (1/s) the perception of structure in circular FW 0.57 2.02 ± 2.57 1.59 2.45 Glass patterns 8 . As these units have HRW 0.62 3.56 ± 2.92 2.01 1.00 properties similar to a subset of primate 0.77 6.33 ± 4.24 1.33 0.46 V4 neurons10–12, it is hypothesized that BK 0.91 32.67 ± 46.78 n/a n/a the competitive neural network devel- EL 0.62 2.24 ± 1.93 1.72 1.56 oped here reflects human V4 activity8,9. V4 Model Results from fMRI (James et al., Invest. Mean visibilities and mean durations are reported for position 1 (center of pattern). The two gamma paraOphthalmol. Vis. Sci. 40, S819, Abstr. meters are from least mean squares fits of K (λt)n exp (–λt) to histograms of the duration data (see Fig. 4313, 1999) and event-related poten- 6). No gamma parameters could be calculated for EL because of the very long durations and consequent tials15 indicate that human V4v is more small number of duration data. Model results fall within the data range for the first three subjects, and agreement with EL can be obtained by a small shift in one model parameter (see text). strongly activated by concentric and nature neuroscience • volume 3 no 2 • february 2000
173
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Fig. 4. Pseudocolor representation of model V4 concentric unit8 responses to the Marroquin pattern. (a) From maximum to zero, responses are plotted in white, yellow, red, dark red and black. Model responses at the three high points (positions 1, 7 and 10) and two low points (positions 5 and 8) of the human data are marked. Relative model responses at all ten positions agree well with mean human data (Fig. 2c). (b) One frame of the neural network simulation in equation (2). The small cross-shaped patches are active local islands of E neurons that have suppressed all other neural activity in their vicinity. ‘Illusory circles’ have been added by convolving the network activity pattern with a circle representing the effective input to these neurons from the Marroquin patterns. The circles thus represent the percept signaled by network activity. (An animation of V4 network dynamics may be viewed on the web at http://neurosci.nature.com/web_specials/)
a
b
10 8
1
© 2000 Nature America Inc. • http://neurosci.nature.com
7 5
grouping have not attempted to explain the Marroquin illusion. It is not clear how such a model might operate, but it will be interesting to see whether alternative approaches can provide a comparable fit to our psychophysical data. In any event, it will still be necessary to incorporate regional inhibitory interactions and adaptation to account for the observed perceptual oscillations. Both the data and model reported here show similarities to binocular rivalry. The Marroquin illusion and rivalry both generate visibility intervals well approximated by a gamma distribution 23,24,35 . In addition, rivalry has been modeled by competitive interactions plus fatigue36, and there is evidence that rivalry is not chaotic37,38. Finally, it has been shown that disappearances such as those of the Marroquin circles are similar to binocular rivalry and are not caused by eye movements39. 3D model
174
Modifications of the current model may therefore be useful in explaining the patchwork percept and spreading waves in binocular rivalry. There have been several theoretical proposals that spatial attention may reflect the activity of winner-take-all networks40,41. Furthermore, studies of primate V4 demonstrate prominent attentional effects18–21,42–44. This work has led to the proposal that selective attention results from biasing of competitive interactions in parallel networks22. It is therefore reasonable to hypothesize that the parallel competitive network embodied in equation (2) reflects one substrate for selective attention operating among V4 units. If so, a novel form of network biasing suggests itself: localized reduction of spike-frequency adaptation controlled by modulatory neurotransmitters. Changes in the magnitude of spike-frequency Model cross section
Fig. 5. Schematic of the complete V4 concentric unit dynamical model illustrated both in perspective (left) and in cross-section (right) for clarity. V1 filtering was performed at 12 different simple cell orientations spaced at 15° intervals. The filtered response at each orientation was then full-wave rectified and filtered by a larger second-stage oriented filter (hypothesized to reside in V2) at an orthogonal orientation, a sequence of operations that extracts curvature information27,28. Finally, responses of 24 concentrically arranged second-stage filters are summed linearly (S in the model cross section) to produce the input to model V4 concentric units. Further details of this feedforward model for concentric V4 units were reported previously8,9. At the V4 stage, these units engage in competitive lateral inhibition (lines with solid circles at the top of the diagram) over spatial regions defined by the masking function in equation (1). Given the dimensions of the connectivity function, each neuron inhibited a circular region comprising approximately 12% (at 1/e level) of the 64 × 64 network. There was no inhibition between a unit and itself or its two nearest neighbors in each direction. nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
a Transient
Spike rate
Inhibition
Time (s)
b Model Gamma
FW Gamma n = 103
Interval count
Fig. 6. Comparison of model net work responses and human data. (a) Temporal response of the model E neuron in position 1 (center of the network) is plotted. Following a transient overshoot when the neuron escapes from inhibition and switches on, the rapid drop of the spike rate to about 1/3 of the initial peak value results from spike-frequency adaptation mediated by H in equation (2). Small fluctuations in firing level during the subsequent plateau result from time-varying inhibition arising from oscillations elsewhere in the network. Ultimately, competition and spike-frequency adaptation cause the neuron to cease firing. Histograms of visibility durations at position 1 are shown for both subject FW (b) and the V4 model (c). Both are well fit by a γ distribution (parameters in Table 1).
Interval count
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
n = 478
adaptation would have a small effect on the initial transient response of cortical neurons, but would significantly enhance the subsequent asymptotic firing level; Interval duration (s) Interval duration (s) this time course of adaptational effects is observed in primate V4 neurons21. Aspects of selective attention in visual areas V1 and V2 series of visibility durations was obtained. Each experiment was cenmight be explained by incorporating recurrent connections from tered at one of ten points in the Marroquin pattern, and each experithe V4 model to these areas, thus generating a competitive attenment lasted two min. To minimize fading of dots due to retinal adaptation, the dots were counterphase flickered between black and tional hierarchy41. Delayed figure–ground enhancements observed white at 1.5 Hz, which made the task considerably easier for subjects. in V1 might also be explained by such feedback to V1 from V4 Data were collected at all fixation points on each of three days, with concentric units45. points measured in pseudo-random order each day. Despite their intrinsic fascination, illusions attain their primary significance as windows for glimpsing underlying visual Modeling. Simulations of equation (2) were conducted in MatLab™ processes. From this perspective, the Marroquin illusion may be software on a Macintosh G3 computer using a Runge-Kutta routine viewed as the result of presenting a dense set of competing stimwith constant step size. Before solving the differential equations, we uli to an attentional network. Similarly, the oscillation triggered applied the concentric V4 unit model8 consisting of oriented V1 filby this set of stimuli may be construed as a form of neural search tering, full-wave rectification, orthogonal V2 filtering and final consequence incorporating inhibition of return46,47 mediated by spikecentric linear pooling to a 512 × 512 portion of the Marroquin pattern. frequency adaptation. We have presented evidence that model V4 To reduce the size of the simulation, this filtered input to V4 concenconcentric units can detect ellipsoidal objects in complex scenes tric units was subsampled down to 64 × 64. This was carefully done in order to retain the symmetries in the V4 processed image (Fig. 1b) and that such units interact via spatially regional win(see Fig. 4a). Equation (2) therefore represents a system of 3 × 642 or ner-take-all competition. Given evidence for object-based atten12,288 coupled nonlinear differential equations. The first-stage filters 17 tion , this raises the exciting possibility that further study of V4 were derived from earlier masking studies with parameters for 16.0 concentric units may help to elucidate the physiological bases of cycles per degree48. The second-stage filters were scaled for the firstsuch attentional processes. stage filters (16.0 cycles per degree) from values previously reported8.
METHODS Psychophysics. Marroquin patterns were generated by superimposing three square dot grids rotated by ±60° with respect to each other. At the viewing distance of 1.5 m, each dot subtended 40.6 arc s, and the spacing between the dots in the square grids was 10.8 arc min. Overall, the Marroquin pattern subtended 8.12° × 8.12°. The dots were at 100% contrast and superimposed on a background of mean luminance 50.5 cd per m2. In each experiment, three collinear dots were colored red: a central one that was fixated by the subject and two others located on the diameter of an illusory circle (see line in Fig. 1a) that the subject was instructed to monitor. The subject’s task was to fixate the center red dot and depress the mouse button whenever a concentric, illusory circle was perceived to pass through the two flanking red dots. By recording the times at which the mouse button was depressed and released, a time nature neuroscience • volume 3 no 2 • february 2000
FFTs were used to evaluate the summation in the definition of p in equation (2), so boundary conditions were periodic. As p represents the postsynaptic input to excitatory neurons, which are described by typical spike rate equations27, p provides an input to the Naka-Rushton function31 that is positive or zero: p+ = max (p, 0). This thresholding ensured that negative postsynaptic potentials produced a zero firing rate. The maximum rate (100) and semi-saturation (10) of the Naka-Rushton function were chosen to produce oscillations in the network given the strength of the filtered V4 model inputs. The equation for the I neurons is linear for mathematical convenience; an I equation with a Naka-Rushton rate nonlinearity and suitable parameters produces very similar results. Because of the wide range of time constants (8–400 ms), these are ‘stiff ’ equations, so a series of preliminary simulations were run to determine an appropriate time step for the simulations, which turned out to be 0.05 ms. The maximum Lyapunov 175
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
exponent was computed by comparing the main trajectory at each time step with a second that started the interval displaced a distance of 10–6 in the state space of the system. This was repeated throughout the entire 2.0 min of each simulation, and the maximum Lyapunov exponent was then estimated using standard formulas27. Note: An animation of V4 network dynamics can be found on the Nature Neuroscience web site (http://neurosci.nature.com/web_specials/).
ACKNOWLEDGEMENTS This research was supported in part by NIH grant #EY02158 to H.R.W., by a grant from Research to Prevent Blindness to the University of Chicago and by NSERC grant #OGP0007551 (Canada) to F.W.
© 2000 Nature America Inc. • http://neurosci.nature.com
RECEIVED 23 AUGUST; ACCEPTED 3 DECEMBER 1999 1. Barrett, C. Op Art (Studio Vista, London, 1970). 2. Wade, N. J. Op art and visual perception. Perception 7, 21–46 (1977). 3. Marroquin, J. L. Human Visual Perception of Structure. Master’s thesis, MIT (1976). 4. Marr, D. Vision: A Computational Investigation into the Human Representation and Processing of Visual Information 49–50 (Freeman, San Francisco, 1982). 5. Stevens, K. A. & Brookes, A. Detecting structure by symbolic constructions on tokens. Comput. Graph. Image Process. 37, 238–260 (1987). 6. Glass, L. Moiré effect from random dots. Nature 223, 578–580 (1969). 7. Glass, L. & Pérez, R. Perception of random dot interference patterns. Nature 246, 360–362 (1973). 8. Wilson, H. R., Wilkinson, F. & Asaad, W. Concentric orientation summation in human form vision. Vision Res. 37, 2325–2330 (1997). 9. Wilson, H. R. & Wilkinson, F. Detection of global structure in Glass patterns: implications for form vision. Vision Res. 38, 2933–2947 (1998). 10. Gallant, J. L., Braun, J. & Van Essen, D. C. Selectivity for polar, hyperbolic, and Cartesian gratings in macaque visual cortex. Science 259, 100–103 (1993). 11. Gallant, J. L., Connor, C. E., Rakshit, S., Lewis, J. W. & Van Essen, D. C. Neural responses to polar, hyperbolic, and Cartesian gratings in area V4 of the macaque monkey. J. Neurophysiol. 76, 2718–2739 (1996). 12. Kobatake, E. & Tanaka, K. Neuronal selectivities to complex object features in the ventral visual pathway of the macaque cerebral cortex. J. Neurophysiol. 71, 856–867 (1994). 13. Mishkin, M., Ungerleider, L. G. & Macko, K. A. Object vision and spatial vision: two cortical pathways. Trends Neurosci. 6, 414–417 (1983). 14. Van Essen, D. C., Anderson, C. H. & Felleman, D. J. Information processing in the primate visual system: an integrated systems perspective. Science 255, 419–423 (1992). 15. Allison, T., Puce, A., Spencer, D. D. & McCarthy, G. Electrophysiological studies of human face perception. I: Potentials generated in ocippitotemporal cortex by face and non-face stimuli. Cereb. Cortex 9, 415–430 (1999). 16. Wilson, H. R., Wilkinson, F., Lin, L. M. & Castillo, M. Perception of head orientation. Vision Res. (in press). 17. O’Craven, K. M., Downing, P. E. & Kanwisher, N. fMRI evidence for objects as the units of attentional selection. Nature 401, 584–587 (1999). 18. Motter, B. C. Neural correlates of feature selective memory and pop-out in extrastriate area V4. J. Neurosci. 14, 2190–2199 (1994). 19. Connor, C. E., Preddie, D. C., Gallant, J. L. & Van Essen, D. C. Spatial attention effects in macaque area V4. J. Neurosci. 17, 3201–3214 (1997). 20. Luck, S. J., Chelazzi, L., Hillyard, S. A. & Desimone, R. Neural mechanisms of spatial selective attention in areas V1, V2, and V4 of macaque visual cortex. J. Neurophysiol. 77, 24–42 (1997).
176
21. McAdams, C. J. & Maunsell, J. H. R. Effects of attention on orientation tuning functions of single neurons in macaque cortical area V4. J. Neurosci. 19, 431–441 (1999). 22. Desimone, R. & Duncan, J. Neural mechanisms of selective visual attention. Annu. Rev. Neurosci. 18, 193–222 (1995). 23. Fox, R. & Herrmann, J. Stochastic properties of binocular rivalry alternations. Percept. Psychophys. 2, 432–436 (1967). 24. Blake, R. A neural theory of binocular rivalry. Psychol. Rev. 96, 145–167 (1989). 25. Dobbins, A., Zucker, S. W. & Cynader, M. S. Endstopped neurons in the visual cortex as a substrate for calculating curvature. Nature 329, 438–441 (1987). 26. Wilson, H. R. & Richards, W. A. Curvature and separation discrimination at texture boundaries. J. Opt. Soc. Am. A 9, 1653–1662 (1992). 27. Wilson, H. R. Spikes, Decisions, and Actions: Dynamical Foundations of Neuroscience (Oxford Univ. Press, Oxford, 1999). 28. Connors, B. W. & Gutnick, M. J. Intrinsic firing patterns of diverse neocortical neurons. Trends Neurosci. 13, 99–104 (1990). 29. Foehring, R. C., Lorenzon, N. M., Herron, P. & Wilson, C. J. Correlation of physiologically and morphologically identified neuronal types in human association cortex in vitro. J. Neurophysiol. 66, 1825–1837 (1991). 30. Lorenzon, N. M. & Foehring, R. C. Relationship between repetitive firing and afterhyperpolarizations in human neocortical neurons. J. Neurophysiol. 67, 350–363 (1992). 31. Naka, K. I. & Rushton, W. A. S-potentials from colour units in the retina of fish. J. Physiol. (Lond.) 185, 584–599 (1966). 32. Albrecht, D. G. & Hamilton, D. B. Striate cortex of monkey and cat: contrast response function. J. Neurophysiol. 48, 217–237 (1982). 33. Sclar, G., Maunsell, J. H. R. & Lennie, P. Coding of image contrast in central visual pathways of the macaque monkey. Vision Res. 30, 1–10 (1990). 34. McCormick, D. A. & Williamson, A. Convergence and divergence of neurotransmitter action in human cerebral cortex. Proc. Natl. Acad. Sci. USA 86, 8098–8102 (1989). 35. Borsellino, A., De Marco, A., Allazetta, A., Rinesi, S. & Bartolini, B. Reversal time distribution in the perception of visual ambiguous stimuli. Kybernetik 10, 139–144 (1972). 36. Lehky, S. An astable multivibrator model of binocular rivalry. Perception 17, 215–228 (1988). 37. Richards, W., Wilson, H. R. & Sommer, M. A. Chaos in percepts? Biol. Cybern. 70, 345–349 (1994). 38. Lehky, S. R. Binocular rivalry is not chaotic. Proc. R. Soc. Lond. B Biol. Sci. 259, 71–76 (1995). 39. Wade, N. J. Distortions and disappearances of geometrical patterns. Perception 6, 407–433 (1977). 40. Koch, C. & Ullman, S. Shifts in selective visual attention: towards the underlying neural circuitry. Hum. Neurobiol. 4, 219–227 (1985). 41. Tsotsos, J. K. Analyzing vision at the complexity level. Behav. Brain Sci. 13, 423–469 (1990). 42. Motter, B. C. Focal attention produces spatially selective processing in visual cortical areas V1, V2, and V4 in the presence of competing stimuli. J. Neurophysiol. 70, 909–919 (1993). 43. De Weerd, P., Peralta, M. R., Desimone, R. & Ungerleider, L. G. Loss of attentional stimulus selection after extrastriate cortical lesions in macaques. Nat. Neurosci. 2, 753–758 (1999). 44. Reynolds, J. H., Chelazzi, L. & Desimone, R. Competitive mechanisms subserve attention in macaque areas V2 and V4. J. Neurosci. 19, 1736–1753 (1999). 45. Zipser, K., Lamme, V. A. F. & Schiller, P. H. Contextual modulation in primary visual cortex. J. Neurosci. 16, 7376–7389 (1996). 46. Posner, M. I., Cohen, Y., Choate, L. S., Hockey, R. & Maylor, E. in Preparatory States and Processes (eds. Kornblum, S. & Requin, J.) 49–65 (Erlbaum, Hillsdale, New Jersey, 1984). 47. Maylor, E. A. & Hockey, R. J. Inhibitory component of externally controlled covert orienting in visual space. J. Exp. Psychol. Hum. Percept. Perform. 11, 777–787 (1985). 48. Wilson, H. R. in Spatial Vision (ed. Regan, D.) 64–86 (MacMillan, London, 1991).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Motion perception during saccadic eye movements Eric Castet and Guillaume S. Masson Centre de Recherche en Neurosciences Cognitives (CRNC), UPR 9012 du CNRS31, chemin J. Aiguier13402, Marseille cedex 20, France
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to E.C. (
[email protected])
During rapid eye movements, motion of the stationary world is generally not perceived despite displacement of the whole image on the retina. Here we report that during saccades, human observers sensed visual motion of patterns with low spatial frequency. The effect was greatest when the stimulus was spatiotemporally optimal for motion detection by the magnocellular pathway. Adaptation experiments demonstrated dependence of this intrasaccadic motion percept on activation of direction-selective mechanisms. Even two-dimensional complex motion percepts requiring spatial integration of early motion signals were observed during saccades. These results indicate that the magnocellular pathway functions during saccades, and that only spatiotemporal limitations of visual motion perception are important in suppressing awareness of intrasaccadic motion signals.
During saccadic eye movements, we do not perceive the world as moving. This observation is paradoxical because high-speed retinal motion can be detected with static eyes, provided it is produced by patterns with low spatial frequency1. Therefore, it is widely assumed that motion perception is ‘switched off ’ during saccades. Based on psychophysical results reporting decreased intrasaccadic sensitivity (for instance, to contrast), two radically different theories account for the absence of conscious motion perception during saccades. The first approach postulates that extraretinal signals triggered by saccades actively suppress intrasaccadic motion processing2,3. Alternatively, some researchers propose that visual factors alone might be involved. For example, intrasaccadic information can be effectively masked by preand postsaccadic visual activations4,5. The general issue of intrasaccadic motion processing remains unclear. Notably, proposals concerning the physiological implementation of extraretinal suppression raise a number of problems. The visual system comprises two relatively independent pathways from the retina to the cortex. One pathway, which extends from the magnocellular subdivision in the lateral geniculate nucleus (LGN) to the parietal cortex, is thought to be important for assessing motion6,7. This ‘magnocellular pathway’ contains neurons responding optimally to gratings of low spatial and high temporal frequencies8,9. It is proposed, based on psychophysical results, that the magnocellular pathway is inactivated during the saccade by selective suppression in the LGN 10,11. However, no physiological evidence supports this claim. Moreover, neurons in the middle temporal area (MT) of awake monkeys can be transiently activated by the visual flow created by fixational saccades12, suggesting that precortical suppression of the motion pathway is unlikely. Furthermore, such suppression would be surprising, as there is reason to believe that the essential functions of the magnocellular stream are still needed during saccades, whether or not they contribute to conscious awareness13. Therefore, it was important to investigate how much intrasaccadic information is available in the magnocellular stream. nature neuroscience • volume 3 no 2 • february 2000
The ability to detect a two-frame displacement briefly presented during the saccade is well studied14,15. It is unclear if displacement perception involves activation of low-level motion detectors within the magnocellular pathway or a different process, like attentional tracking of a moving object’s successive positions16,17. Attempts to assess intrasaccadic motion perception using stimuli more specifically linked to early cortical motion processing are scarce. Intrasaccadic retinal stimuli used in most studies do not optimally activate magnocellular motion detectors. As a result, human capacity for intrasaccadic motion processing is probably largely underestimated. In brief, visual functions that might be carried out by the magnocellular stream during saccades, including low-level motion processing, are currently poorly understood. We present direct evidence for intrasaccadic motion perception mediated by low-level motion signals transmitted through the magnocellular pathway. Our experiments pinpoint the relevant visual factors that must be optimized to produce a clear, conscious sensation of visual motion during saccades.
RESULTS Motion detection The basic stimulus consisted of a vertical grating with low spatial frequency (0.17 cycles per degree) moving at a constant high speed (360° per s). With static eyes, the low-contrast grating (10%) was above the critical fusion frequency and was therefore invisible18. While the grating was continuously drifting, observers were required to make horizontal saccades between two fixation points whose spatial separation was varied across trials to alter eye velocity. The eye speed was concurrently measured in three observers who had to report whether or not grating motion was perceived during the saccade (yes/no task). Whenever saccades of moderate amplitudes (∼6°) were made in the direction of the grating, a compelling perception of bars drifting in the direction of the grating occurred during the saccade. Mean velocity profiles of saccades of different amplitudes for one observer were plotted (Fig. 1a). The highest speed reached during a saccade increased 177
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Horizontal velocity (degrees per second) Horizontal velocity (∞/s)
b
Peak velocity Peak velocity (degrees(∞/s) per second)
b
a
Saccade amplitude (degrees) Saccade amplitude (∞)
cc perceiving motion
Probability of perceiving Probability of motion
© 2000 Nature America Inc. • http://neurosci.nature.com
Time (ms) Time (ms)
Peak velocity (degrees per second) Peak velocity (∞/s)
Fig. 1. Motion perception during a saccade in the same direction as a high-speed vertical grating (10% contrast). (a) Eye speed during leftward saccades (observer EC) as a function of time and saccade amplitude. Dashed line shows constant speed of a leftward-moving grating. For each saccade amplitude (two indicated by arrows), the mean velocity profile was obtained from aligning onsets of individual saccades and averaging their velocity profiles. (b) Dependence of peak velocity on saccade amplitude. For each combination of saccade amplitude and grating speed (solid symbols, 360° per s; open symbols, 300° per s), we measured the mean saccadic peak velocity by averaging individual peak velocities. (c) Probability of perceiving motion as a function of saccadic peak velocity for three observers. Gratings moving at either 360° per s (filled symbols) or 300° per s (open symbols) were presented in successive blocks. Error bars to right show average s.e. For all observers, the two inverted U-shaped curves were laterally shifted by 60° per s (horizontal arrows).
with saccade amplitude19,20 (Fig. 1b). The probability of perceiving motion depended on this saccadic peak velocity (Fig. 1c). With gratings either at 360° per s (solid symbols) or 300° per s (open symbols), the data curves resembled an inverted U and were laterally shifted by a peak-velocity difference of about 60° per s (horizontal arrows). This value corresponded to the difference between the two grating speeds. These results strongly suggest that motion perception depends on the difference between the peak eye velocity and grating speed; the relevant factor is the speed (or temporal frequency) of the grating relative to the retina. This is best seen when data from Fig. 1c are replotted as a function of the retinal temporal frequency at the peak of the saccade (Fig. 2a). Here the two curves are superimposed, peaking between 10 and 25 Hz, depending on the observer. The phenomenon can be understood if we look at the effective spatiotemporal stimulus at the retinal level. The retinal speed (and temporal frequency) of the grating was high at the beginning of the saccade and decreased until the peak was reached. After the peak, retinal speed increased again (Fig. 1a). We propose that this constantly changing retinal temporal frequency 178
partly explains the usual impairment of intrasaccadic motion processing. This derives from two fundamental spatiotemporal characteristics of motion detection. First, individual low-level motion detectors only respond to a restricted range of spatiotemporal frequencies21–23, and second, they need a minimum amount of time to integrate motion energy24. Thus, for any spatial-frequency channel, the temporal frequency at the retinal level changes too rapidly to provide a reliable signal, at least during the early acceleration and late deceleration phases of the velocity profile. However, within a brief period during which the velocity peaks, retinal temporal frequency is relatively constant. It is during this critical period that motion detectors could be effectively activated, provided the spatiotemporal combination were optimal. This hypothesis is fully consistent with our motion effect. With small saccades, the temporal frequency of the grating relative to the retina was too high even when the peak velocity was reached (Fig. 2a). For instance, with a 2° saccade, the retinal temporal frequency at the peak was about 40 Hz (240° per s), much too close to the fusion frequency to produce a clear motion percept. With medium saccades, motion perception was nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Response (impulses/sec) (impulses/s) Response
© 2000 Nature America Inc. • http://neurosci.nature.com
Probability of of Probability perceiving perceivingmotion motion
optimal, because these saca cades yielded retinal temporal frequencies around the peak that fell within the optimal temporal range for motion detection 25 . With large saccades (when the peak velocity approaches the grating speed—null relative speed), static visual channels are optimally activated. Observers report that the sense of motion is lost and replaced by the perception of b a ‘flashed’ grating. A previous study has shown that stabilizing the retinal image of a rapidly moving grating with a saccade produces a ‘static flash’ percept26. However, observers did not report motion perception, presumably because the single spatial frequency used (1 cycle per degree) was too Temporal frequency (Hz) high. Beside making stimuli non-optimal for the magnocellular pathway, high spatial frequencies present another problem: during a saccade, the range of retinal temporal frequencies swept through over a given period increases proportionally with spatial frequency. As a result, the restricted range of temporal frequencies required for motion processing within a single temporal-frequency channel is encountered for shorter periods as spatial frequency is increased. Thus, this period is approximately sixfold shorter in the previous study26 than in ours, possibly accounting for the failure to perceive intrasaccadic motion with high spatial frequencies. Processing intrasaccadic visual motion under our protocol requires integrating different speeds across time, presumably by some form of averaging, within a brief period of ∼25 ms. We tested the ability to process this kind of visual stimulus with static eyes. For each saccade amplitude previously tested, a 25ms stimulus with 3 different grating speeds was created to approximate the variation in speeds experienced near the saccadic peak velocity (see Methods). Again, subjects indicated whether or not motion was perceived. The results were qualitatively similar to that obtained during saccades: for low contrasts, probability of perceiving motion as a function of ‘peak’ retinal temporal frequency was an inverted U-shaped curve. Quantitative differences were demonstrated by observer EC (triangles, Fig. 2a). The leftward shift of the curve probably reflects the different perceptual criterion used for this task. Contrast sensitivity was also higher in the ‘static eye’ condition: with a 10% contrast grating (as in the intrasaccadic task), high temporal frequencies were not above fusion frequency and, therefore, produced motion perception (solid triangles). By halving contrast, motion perception was decreased for these high frequencies, yielding an inverted U-curve (open triangles). It is impossible to determine whether this sensitivity difference results from extraretinal or visual factors, mainly because the effective retinal stimulus differs between experimental conditions. nature neuroscience • volume 3 no 2 • february 2000
Peak retinal temporal frequency (Hz)
Fig. 2. Temporal tuning of motion perception. (a) Data in Fig. 1c replotted as a function of retinal temporal frequency at the peak of the saccade (circles). Positive and negative abscissa values denote retinal motion in the same direction as the saccade and in the opposite direction, respectively. Triangles, data obtained for observer EC during fixation. The stimulus was a 25-ms movie (4 frames) crudely approximating the different retinal temporal frequencies experienced around the peak velocity of the saccade. The grating contrast was either 10% (solid triangles) or 5% (open triangles). (b) Temporal tuning curve of a V1 magnocellular cell measured with a 0.9-cycle-perdegree grating (replotted from ref. 8). This cell is direction selective and projects to area MT.
We showed that a saccade toward a high-speed grating of low spatial frequency could produce a clear motion percept: the grating briefly appeared to move in the direction of the saccade. This percept was optimal when the retinal stimulus was within the range for motion detection during the period including peak velocity. The optimal retinal temporal frequencies for motion detection (10–25 Hz; Fig. 2b) were consistent with the broad and high-cutoff tuning curves of direction-selective cells in primate striate cortex8,9. Direction discrimination Possible inconsistency in criteria for motion percepts across observers and runs may be a weakness of the previous study. This may explain why peak values of the inverted U-curves differed for different observers (Fig. 2a). To overcome this, we also measured thresholds for direction discrimination. Because direction selectivity is an essential property of early motion detectors, a direction discrimination task further probed the involvement of motion pathways in intrasaccadic motion perception. We predicted that perceived direction would oppose the direction of the saccade when the peak of the velocity profile exceeded the grating speed for a sufficiently long duration. To test this, a grating whose speed (or equivalent temporal frequency) was controlled by an adaptive-staircase procedure was presented on each trial as before. Observers made large saccades of constant amplitude (14°) and reported whether perceived motion was in the same direction as the saccade (forward response) or its opposite (backward response). Using 2 staircases, we could assess the grating speeds producing forward responses with probabilities of 0.29 and 0.71. Backward percepts appeared less vivid than forward percepts, presumably because of concurrent activation of static channels during the two brief periods when eye and grating speeds matched. The point of subjective stationarity (PSS) was determined by tracking the speed of a grating that produced a static percept (equiprobable forward and backward responses). 179
© 2000 Nature America Inc. • http://neurosci.nature.com
PSS = 355°/s
PSS = 358°/s
PSS = 347°/s
Backward Backward
Forward Forward
Backward Backward
Forward Forward
Backward Backward
Forward Forward
Direction-specific adaptation Although the spatiotemporal selectivity of these motion effects suggests the involvement of early motion detectors, one could argue that the percept is merely due to static mechanisms recruited to detect a temporal change of position16,17. To rule out this possibility, we used a classic protocol for direction-specific adaptation27. A vertical high-contrast adapting grating (12 Hz, 0.17 cycles per degree, 72° per s) covering the whole screen was presented while observers stared at a fixation point. Its temporal frequency was chosen to optimally activate motion detectors25. During the Fig. 3. Direction discrimination experiment. Thresholds for perceiving motion either in the test period, a vertical grating (50 Hz, 0.17 direction of the saccade (forward) or in the opposite direction (backward). Forward and backward thresholds respectively correspond to grating speeds larger and smaller than the average cycles per degree, 300° per s) of variable contrast presented in the top or bottom half of saccadic peak velocity. the screen was moved either in or opposite to the adapting direction. Observers were required to make saccades in the same direction as the test grating and to indicate the part of the screen in Thresholds for all observers lay within a 25°–35° per s range which the intrasaccadic motion was perceived. The saccade (4–6 Hz): ‘forward’ differential thresholds correspond to the difamplitude for each observer was chosen to optimize motion ference between 0.71 and 0.50 levels, and ‘backward’ thresholds perception (as assessed in the first experiment). Contrast correspond to the 0.50–0.29 difference (Fig. 3). thresholds were dramatically increased when the adapting and For comparison, we also measured these direction-discrimitest gratings were in the same direction, whereas adaptation in nation thresholds during fixation. The stimulus was a 25-ms movie the opposite direction had only a slightly detrimental effect of 4 frames simulating 3 successive speeds around the peak of a (Fig. 4; comparison of across-observer means, t 2 = 8; 14° saccade. We varied the average speed from a few degrees per second to the left to a few degrees per second to the right. Meap = 0.015). This direction-specific threshold elevation is a classured thresholds (observers E.C., G.S.M., data not shown) were sic signature of an early direction-sensitive mechanism27. In four- to sixfold lower than those during saccades (Fig. 3). Howevprimates, direction selectivity is a visual property that starts at er, it is impossible to assess whether this decrease was related to the level of the primary visual cortex28. Therefore, this finding extraretinal signals or to visual factors alone, especially as retinal is at odds with suggestions that the activity of the magnocelstimuli differed between conditions. One clear difference was that, lular pathway (constituting the dominant input to motion because of the large saccade, the effective stimulus width for the detectors 6,7) is suppressed at a precortical level during sacintrasaccadic condition was narrower (about 12°) than the full cades10,11. screen available during the fixation condition (27°). As a result, spatial integration mechanisms could not be as efficient as during Two-dimensional motion perception fixation. Moreover, the screen edges sweeping over peripheral retiIn the experiments above, the perceived direction of the na may produce lateral masking. Intrasaccadic thresholds may also intrasaccadic percept always matched the axis of the saccade be inflated by variability in peak saccade speed across trials, as we itself. This coincidence raises the possibility that the percept used average, rather than trial-by-trial, eye speed. Therefore, inveswas actually determined by an extraretinal signal associated tigating the relative influence of visual versus extraretinal factors on direction discrimination during saccades requires further research. Here, the relevant difference between fixation and intrasaccadic thresholds concerned the PSS. During saccades, the PSS (above each graph in Fig. 3) was smaller than the average saccadic peak velocity (370° per s), so the corresponding retinal speed averaged over 25 ms was close to zero (mean, –6° per s). This suggests that stationarity is perceived when retinal speeds within ∼25–30 ms are of opposite directions and thus approximately average to Opposite zero, consistent with our measurement of the PSS during fixation at nearly 0° per s. Same In summary, the intrasaccadic ability to Fig. 4. Direction-selective adaptation. Observers made horizontal saccades and detected discriminate between ‘forward’ and ‘back- whether a horizontally moving test grating was located in the top or bottom half of the screen ward’ directions supports our hypothesis that (spatial 2AFC). Contrast sensitivity was measured with or without adaptation to a moving gratdirection signals relevant to the task are ing. The data clearly show direction-selective adaptation: contrast-threshold elevation (relative indeed extracted during a short period in to the unadapted condition) was larger when the adapting grating was in the same rather than in which eye velocity peaks. the opposite direction. Contrast threshold Contrast threshold elevation elevation
© 2000 Nature America Inc. • http://neurosci.nature.com
Threshold (degrees per second)
articles
180
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
a
b
Fig. 5. Perceived direction of two-dimensional motion. (a) Stimuli were oblique (45°) moving gratings (contrast 30%; temporal frequency as before) presented within square (20° × 20°) or rectangular (20° × 10°) apertures. As before, observers made horizontal saccades of optimal amplitude and then rotated an arrow in the middle of the screen to indicate the direction of perceived intrasaccadic motion. (b) Distributions of perceived directions in polar coordinates. The origin (0°) of the angular axis represents the motion component perpendicular to the bars of the grating. The radial axis plots, in log coordinates, the number of observations collected for each direction. Mean direction is given by µ. With a square aperture, perceived directions cluster around the perpendicular component. With a rectangular aperture, perceived directions are parallel to the long axis (barberpole illusion).
with the saccade14. To avoid this confounding effect, we used the display from the first experiment but rotated the moving grating by 45° and presented it within a large square aperture (Fig. 5a, top). Observers made horizontal saccades of optimal amplitudes, and then adjusted the direction of an arrow presented on the screen to report the perceived direction of the intrasaccadic percept. The distribution of the perceived directions was centered around the grating direction (Fig. 5b, top), as would be expected if motion detectors with the preferred oblique orientation matching the grating orientation were activated in this condition. Furthermore, motion perception of real complex objects requires the spatial integration of different local motion signals that are not in the direction of the eye movements29,30. If early motion signals are not suppressed during saccades, as suggested by previous experiments, one could argue instead that integration of these signals into a two-dimensional velocity signal is actively suppressed. A classic stimulus used to study motion integration is the barber-pole illusion 31 : when an oblique grating moves within a rectangular, rather than square, aperture, its perceived motion is parallel to the long side of the aperture. This phenomenon, which indicates the importance of the motion signals elicited near aperture borders32,33, was also tested. The height of the aperture used before was simply halved to obtain a horizontal ‘barber-pole’ (Fig. 5a, bottom). All observers perceived the classic barber-pole illusion—here, in a horizontal direction (Fig. 5b, bottom). Intrasaccadic motion perception based on activation of low-level detectors tuned to all possible directions followed by integration of the resulting signals, presumably at a second stage29,34,35, is therefore possible during saccades. nature neuroscience • volume 3 no 2 • february 2000
DISCUSSION We show that making saccades in the direction of a rapidly moving grating produced clear motion percepts when retinal image motion (averaged over a critical period around the saccadic peak velocity) was within the motion-detection range. Observers could distinguish between retinal motion in the direction of the saccade and retinal motion in the opposite direction, and perceived a static grating when retinal speed averaged over ∼25–30 ms was close to null. Adapting during fixation to a low spatial and high temporal frequency grating produced a direction-specific reduction in contrast sensitivity to intrasaccadic motion perception. Additionally, spatial integration of early motion signals leading to two-dimensional motion perception was still observed during saccades. We conclude that these intrasaccadic motion percepts revealed the activation of direction-selective mechanisms tuned to low spatial and high temporal frequencies within the magnocellular pathway. We designed the stimulus to optimize intrasaccadic motion perception. First, as the grating was invisible at the beginning (and at the end) of each saccade, there was no pre- or post-saccadic visual information that might have produced forward or backward masking4,5,36,37. Moreover, in contrast to studies using a two-frame sequence, the grating was not abruptly presented during the saccade. Instead, it was continuously displayed on each trial. This point was crucial: the gradual transitions between a retinal temporal range above fusion frequency and an optimal range for motion detection minimized the temporal energy spread and the intrusion of masking transient signals. This optimization allowed a study of motion detection per se rather than displacement detection. The involvement of early motion processing is unclear in numerous studies of intrasaccadic displace181
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
ment perception14,15. Two-frame presentations used in displacement studies are weak stimuli for motion processing. As a consequence, it is possible that performance in these studies might rely exclusively on visual processes that detect changes in position over time16,17. In our experiments, intrasaccadic motion perception was easily experienced when magnocellular motion detection was optimized. In primates, the first stage of motion processing takes place in the striate cortex (V1). The one-dimensional edge-motion signals extracted in V1 are thought to be integrated at a later stage into a two-dimensional velocity signal within the middle temporal area34,35. There is ample evidence that motion perception depends on the activity of MT cells38–40. In addition, MT cells of alert monkeys consistently respond to directional signals induced by randomly directed small-amplitude (about 0.8°) saccades while monkeys fixate12. MT neurons transiently increase their firing rates when these fixational saccades induce a retinal flow in the neurons’ preferred direction, whereas neuronal responses are mildly suppressed when saccades induce null retinal flow. In this framework, the spatiotemporal characteristics of the effects in experiments 1–3 suggest the involvement of direction-selective V1 neurons8,9, whereas motion integration observed in experiment 4 was probably related to MT responses. Our findings suggest that visual factors are the essential determinants of suppression of consciousness of motion during saccades4,5,36,37. Clearly, extraretinal signals do not switch off motion processing. Studies suggesting such suppression actually measured the visibility of static gratings (0 Hz)10,11, and therefore are not inconsistent with our study, which used spatiotemporal stimuli optimized for motion detection by the magnocellular pathway (with low spatial and high temporal frequencies). Our results also pertain to the issue of perceptual stability during eye movements in relation to extraretinal signals14,15. In our experiments, it was striking that a static flash percept occurred when the eye peak velocity equaled the speed of the moving grating. Such a static appearance was inconsistent with the idea that extraretinal signals are used to compensate for the effect of eye movements, as generally assumed with smooth eye movements 41–44. This hypothesis would predict high-speed motion perception of the grating. Therefore, it seems that saccadic eye movements invoke other mechanisms to achieve perceptual stability 13,45 . Alternatively, it is possible that a recalibration process due to extraretinal signals acts more slowly than the actual saccadic eye movements46, or that extraretinal signals carry a damped representation of eye position47. Here we showed that the magnocellular pathway functions during saccades. Indeed, suppression of the magnocellulardominated stream would have important adverse effects48. For instance, the role of the parietal cortex in visual attention49 makes it well suited to alert and orient the visual system toward a peripheral transient signal detected during the saccade. Given the high frequency of saccades in normal vision, future research should examine the behavioral importance of processing intrasaccadic visual information. Our findings do not rule out the possibility that an extraretinal signal alters intrasaccadic visual motion processing. However, we clearly showed that such a putative extraretinal signal does not suppress motion perception during saccades. Therefore, it is more parsimonious to interpret the usual absence of intrasaccadic motion perception as the result of visual and/or attentional factors alone. 182
METHODS Psychophysics. Stimuli were displayed on a 21-inch Sony color monitor (GDM-4011P) driven by a display controller (Cambridge Research System VSG 2/3F, Rochester, UK) with a 160-Hz frame rate. At a viewing distance of 68 cm, the average horizontal separation between adjacent pixels subtended 0.035° of visual angle. The screen subtended 27° × 21°. A lookup table in the software was used to linearize the intensity response of the screen phosphors at an 8-bit luminance resolution. Stimuli displayed during saccades. On each trial, a moving grating of low spatial frequency (0.17 cycles per degree) was displayed for 2 s. During the first 500 ms, the contrast increased using a raised cosine function from 0% to the desired level, which was kept constant for 1000 ms. The contrast then decayed to 0% using the same function during the last 500 ms. A low-pitch sound indicated that the contrast had reached the desired level, prompting saccades. A high-pitch sound, presented when the grating disappeared, prompted observers to respond. The temporal frequency was either 50 Hz (300° per s) or 60 Hz (360° per s) except in the second experiment (direction discrimination), where it was varied with an adaptive procedure. The mean luminance of the grating was 22 cd per m2 (4.5 cd per m2 in the second experiment). Observers AL and YR were naive as to the purpose of the experiments. Stimuli displayed with static eyes. A 25-ms movie was presented at 3 different speeds during fixation by displaying 4 frames of a grating whose spatial phase was appropriately shifted. For each saccade amplitude (tested in the first experiment), 3 retinal speeds centered on the saccadic peak velocity were calculated from the saccadic velocity profiles over 25 ms. For instance, for a 2° amplitude, the 3 successive retinal speeds of the grating were S1, 270° per s (6 ms before the peak), S2, 240° per s (at the peak) and S1 again (6 ms after the peak); average speed, 260° per s. Measurement of eye movements. Horizontal movements of the right eye were recorded using a high-resolution infrared scleral-reflectance system (IRIS Skalar, Delft, Netherlands). Analog signals were digitized at 500 Hz with a 12-bit resolution ADC. A bite bar was used to restrain head movements. Two points of different colors indicated the size and the direction of the saccade to be made. On each trial, a sound instructed observers to make the saccade. Data were analyzed off line. Inappropriate saccades were discarded from the analysis. Direction discrimination. Across trials of the same block, the direction of the saccade (14° amplitude) was constant (leftward or rightward). Observers were required to indicate whether perceived motion of the grating was in the same direction as the saccade (forward) or in the opposite direction (backward). The grating (20% contrast) covered the whole screen and had its temporal frequency controlled by one of 3 staircases with steps of 0.5 Hz50. One staircase (starting value, 360° per s; – 60 Hz) converged on a 0.50 threshold indicating the speed at which the grating appeared static. The two other staircases tracked the 0.29 and 0.71 thresholds. Their starting values, which were 300° per s (50 Hz) and 420° per s (70 Hz) in the training period, were respectively increased and lowered as performance improved across blocks. The actual starting values were randomly chosen within a range of 2 Hz centered on the above values. The end of a block occurred when a minimum of nine reversals had been completed in each staircase. The three thresholds were then estimated by averaging the six last reversals in each staircase. The ‘same direction’ differential threshold (DT) was defined as the difference between the 0.71 and 0.50 levels, and the ‘opposite direction’ DT as the difference between the 0.50 and 0.29 levels. Direction-specific adaptation. Required saccade direction (leftward or rightward, in the direction of the test grating moving at 300° per s) was randomly alternated across trials. For each observer, a constant saccade amplitude was chosen from results of the first experiment to optimize motion perception (4° for EC and 3° for AL and YR). The contrast of the test grating was adjusted with an adaptive staircase procedure converging on a 0.71 threshold (steps of 0.4% contrast)50. Two staircases, each assigned to a grating direction, were randomly interleaved within a block. nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
Contrast thresholds were measured with or without adaptation to a moving grating (80% contrast), which covered the whole screen and had the same spatial frequency as the test grating and a temporal frequency of 12 Hz (optimal for motion detection of low spatial frequencies25). The adapting grating, whose direction was constant within any block, was presented for one minute at the beginning of each block. Observers were then exposed to cycles of test periods (during which one saccade had to be made within 1500 ms) and 10-s adapting periods. Test gratings were presented either in the upper or lower part of the screen (spatial 2AFC). A block ended when a minimum of eight reversals had been completed in each staircase. The two thresholds were then estimated by averaging the last six reversals in each staircase. Two-dimensional motion perception. For a given saccade direction (leftward or rightward), the orientation of the grating was randomized so that the motion component perpendicular to the bars was either above or below horizontal. The two different saccade directions were presented in distinct blocks. The perceived directions plotted in Fig. 5b were averaged over the four possible quadrants (two for each saccade direction). The square and rectangular aperture conditions were randomly interleaved within each block.
ACKNOWLEDGEMENTS We thank L. S. Stone, M. J. Morgan, J. K. O’Regan and A. Riehle for comments on the manuscript.
RECEIVED 19 AUGUST; ACCEPTED 8 DECEMBER 1999 1. Burr, D. C. & Ross, J. Contrast sensitivity at high velocities. Vision Res. 22, 479–484 (1982). 2. Shioiri, S. & Cavanagh, P. Saccadic suppression of low-level motion. Vision Res. 29, 915–928 (1989). 3. Ilg, U. J. & Hoffmann, K. P. Motion perception during saccades. Vision Res. 33, 211–220 (1993). 4. Judge, S. J., Wurtz, R. H. & Richmond, B. J. Vision during saccadic eye movements. I. Visual interactions in striate cortex. J. Neurophysiol. 43, 1133–1155 (1980). 5. Campbell, F. W. & Wurtz, R. H. Saccadic omission: why we do not see a greyout during a saccadic eye movement. Vision Res. 18, 1297–1303 (1978). 6. Maunsell, J. H., Nealey, T. A. & DePriest, D. D. Magnocellular and parvocellular contributions to responses in the middle temporal visual area (MT) of the macaque monkey. J. Neurosci. 10, 3323–3334 (1990). 7. Merigan, W. H., Byrne, C. E. & Maunsell, J. H. Does primate motion perception depend on the magnocellular pathway? J. Neurosci. 11, 3422–3429 (1991). 8. Movshon, J. A. & Newsome, W. T. Visual response properties of striate cortical neurons projecting to area MT in macaque monkeys. J. Neurosci. 16, 7733–7741 (1996). 9. Hawken, M. J., Shapley, R. M. & Grosof, D. H. Temporal-frequency selectivity in monkey visual cortex. Vis. Neurosci. 13, 477–492 (1996). 10. Ross, J., Burr, D. & Morrone, C. Suppression of the magnocellular pathway during saccades. Behav. Brain Res. 80, 1–8 (1996). 11. Burr, D. C., Morrone, M. C. & Ross, J. Selective suppression of the magnocellular visual pathway during saccadic eye movements. Nature 371, 511–513 (1994). 12. Bair, W. & O’Keefe, L. P. The influence of fixational eye movements on the response of neurons in area MT of the macaque. Vis. Neurosci. 15, 779–786 (1998). 13. O’Regan, J. K. Solving the ‘real’ mysteries of visual perception: the world as an outside memory. Can. J. Psychol. 46, 461–488 (1992). 14. Bridgeman, B., Van der Heijden, A. H. C. & Velichkovsky, B. M. A theory of visual stability across saccadic eye movements. Behav. Brain Sci. 17, 247–292 (1994). 15. Li, W. & Matin, L. Saccadic suppression of displacement: separate influences of saccade size and of target retinal eccentricity. Vision Res. 37, 1779–1797 (1997). 16. Braddick, O. J. Low-level and high-level processes in apparent motion. Phil. Trans. R. Soc. Lond. B Biol.Sci. 290, 137–151 (1980).
nature neuroscience • volume 3 no 2 • february 2000
17. Cavanagh, P. Attention-based motion perception. Science 257, 1563–1565 (1992). 18. Robson, J. G. Spatial and temporal contrast sensitivity functions of the visual system. J. Opt. Soc. Am. 56, 1141–1142 (1966). 19. Bahill, A. T., Clark, M. R. & Stark, L. The main sequence, a tool for studying human eye movements. Math. Biosci. 24, 191–204 (1975). 20. Collewijn, H., Erkelens, C. J. & Steinman, R. M. Binocular co-ordination of human horizontal saccadic eye movements. J. Physiol. (Lond.) 404, 157–182 (1988). 21. Morgan, M. J. Analogue models of motion perception. Phil. Trans. R. Soc. Lond. B Biol. Sci. 290, 117–135 (1980). 22. van Santen, J. P. & Sperling, G. Elaborated Reichardt detectors. J. Opt. Soc. Am. A Opt. Image Sci. Vis. 2, 300–321 (1985). 23. Watson, A. B. & Ahumada, A. J., Jr. Model of human visual-motion sensing. J. Opt. Soc. Am. A Opt. Image Sci. Vis. 2, 322–341 (1985). 24. Burr, D. C. Temporal summation of moving images by the human visual system. Proc. R. Soc. Lond. B Biol. Sci. 211, 321–339 (1981). 25. Anderson, S. J. & Burr, D. C. Spatial and temporal selectivity of the human motion detection system. Vision Res. 25, 1147–1154 (1985). 26. Deubel, H., Elsner, T. & Hauske, G. Saccadic eye movements and the detection of fast-moving gratings. Biol. Cybern. 57, 37–45 (1987). 27. Levinson, E. & Sekuler, R. The independence of channels in human vision selective for direction of movement. J. Physiol. (Lond.) 250, 347–366 (1975). 28. Hubel, D. H. & Wiesel, T. N. Functional architecture of macaque monkey visual cortex. Proc. R. Soc. Lond. B Biol. Sci. 198, 1–59 (1977). 29. Adelson, E. H. & Movshon, J. A. Phenomenal coherence of moving visual patterns. Nature 300, 523–525 (1982). 30. Yuille, A. L. & Grzywacz, N. M. A computational theory for the perception of coherent visual motion. Nature 333, 71–74 (1988). 31. Wuerger, S., Shapley, R. & Rubin, N. “On the visually perceived direction of motion” by Hans Wallach: 60 years later. Perception 11, 1317–1367 (1996). 32. Kooi, F. L. Local direction of edge motion causes and abolishes the barber pole illusion. Vision Res. 33, 2347–2351 (1993). 33. Castet, E., Charton, V. & Dufour, A. The extrinsic/intrinsic classification of 2D motion signals with barber-pole stimuli. Vision Res. 39, 915–932 (1999). 34. Albright, T. D. & Stoner, G. R. Visual motion perception. Proc. Natl. Acad. Sci. USA 92, 2433–2440 (1995). 35. Movshon, A. J., Adelson, E. H., Gizzi, M. S. & Newsome, W. T. in Pattern Recognition Mechanisms (eds. Chagas, C., Gattas, R. & Gross, C. G.) 117–151 (Vatican Press, Rome, 1985). 36. Breitmeyer, B. G. & Ganz, L. Implications of sustained and transient channels for theories of visual pattern masking, saccadic suppression, and information processing. Psychol. Rev. 83, 1–36 (1976). 37. Volkmann, F. C. Human visual suppression. Vision Res. 26, 1401–1416 (1986). 38. Salzman, C. D., Britten, K. H. & Newsome, W. T. Cortical microstimulation influences perceptual judgements of motion direction. Nature 346, 174–177 (1990). 39. Britten, K. H., Newsome, W. T., Shadlen, M. N., Celebrini, S. & Movshon, J. A. A relationship between behavioral choice and the visual responses of neurons in macaque MT. Vis. Neurosci. 13, 87–100 (1996). 40. Pasternak, T. & Merigan, W. H. Motion perception following lesions of the superior temporal sulcus in the monkey. Cereb. Cortex 4, 247–259 (1994). 41. Newsome, W. T. & Wurtz, R. H. Probing visual cortical function with discrete chemical lesions. Trends Neurosci. 11, 394–400 (1988). 42. Erickson, R. G. & Thier, P. A neuronal correlate of spatial stability during periods of self-induced visual motion. Exp. Brain Res. 86, 608–616 (1991). 43. Haarmeier, T., Thier, P., Repnow, M. & Petersen, D. False perception of motion in a patient who cannot compensate for eye movements. Nature 389, 849–852 (1997). 44. Matin, L. et al. Oculoparalytic illusion: visual-field dependent spatial mislocalizations by humans partially paralyzed with curare. Science 216, 198–201 (1982). 45. Deubel, H., Bridgeman, B. & Schneider, W. X. Immediate post-saccadic information mediates space constancy. Vision Res. 38, 3147–3159 (1998). 46. Grüsser, O. J., Krizic, A. & Weiss, L. R. Afterimage movement during saccades in the dark. Vision Res. 27, 215–226 (1987). 47. Bockisch, C. J. & Miller, J. M. Different motor systems use similar damped extraretinal eye position information. Vision Res. 39, 1025–1038 (1999). 48. Van Essen, D. C. & DeYoe, E. A. in The Cognitive Neurosciences (ed. Gazzaniga, M. S.) 383–400 (MIT Press, Cambridge, Massachusetts, 1995). 49. Corbetta, M., Miezin, F. M., Shulman, G. L. & Petersen, S. E. A PET study of visuospatial attention. J. Neurosci. 13, 1202–1226 (1993). 50. Levitt, H. Transformed up-down methods in psychoacoustics. J. Acoust. Soc. Am. 49, 467–477 (1971).
183
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Thermosensory activation of insular cortex A. D. Craig1, K. Chen2,3, D. Bandy2 and E. M. Reiman2,4 1 Division of Neurosurgery, Barrow Neurological Institute, 350 West Thomas Rd., Phoenix, Arizona 85013, USA 2 Positron Emission Tomography Center, Good Samaritan Regional Medical Center, Phoenix, Arizona 85006, USA 3 Department of Mathematics, Arizona State University, Tempe, Arizona 85280, USA 4 Department of Psychiatry, University of Arizona, Tucson, Arizona 85721, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to A.D.C. (
[email protected])
Temperature sensation is regarded as a submodality of touch, but evidence suggests involvement of insular cortex rather than parietal somatosensory cortices. Using positron emission tomography (PET), we found contralateral activity correlated with graded cooling stimuli only in the dorsal margin of the middle/posterior insula in humans. This corresponds to the thermoreceptive- and nociceptive-specific lamina I spinothalamocortical pathway in monkeys, and can be considered an enteroceptive area within limbic sensory cortex. Because lesions at this site can produce the poststroke central pain syndrome, this finding supports the proposal that central pain results from loss of the normal inhibition of pain by cold. Notably, perceived thermal intensity was well correlated with activation in the right (ipsilateral) anterior insular and orbitofrontal cortices.
The cutaneous sense of temperature is a distinct form of somatic sensibility mediated by specific primary afferent receptors, yet its representation in the brain is unknown1,2. Thermoreception has two aspects, an exteroceptive, discriminative aspect important for object recognition and environmental exploration and an enteroceptive, affective aspect important for autonomic activity, homeostasis and thermoregulatory behavior. Whereas the former is more obvious and traditionally emphasized, the latter is an essential feature of mammalian physiology. Conceptual recognition that thermal sensibility is an emergent aspect of enteroception (the sense of the physiological condition of the body itself) would accomodate a variety of considerations and have strong implications for other sensations from the body typically regarded as exteroceptive, for instance, the sensation of pain. Temperature and pain sensations are intimately associated functionally and anatomically in the central nervous system— consistent with their common importance for maintenance of body integrity—and they are accordingly integrated. A fundamental interaction, the cold inhibition of pain, is a well established therapeutic phenomenon with a demonstrable central basis3,4. Loss of this interaction, which may result in the disinhibition of pain, is proposed as a possible cause of the post-stroke central pain syndrome5. This syndrome is generally characterized by intractable burning or aching pain referred to deep and cutaneous tissues within a region of paradoxical hypalgesia and thermal hypesthesia. (It occurs in 2–8% of stroke patients and 25–40% of spinal cord injury and multiple sclerosis patients; it is unresponsive to opiates.) Brain lesions that produce this syndrome interrupt the ascending spinothalamic pathway responsible for pain and temperature sensations6,7, and the critical cortical locus lies in a parieto-insular region8. Other findings directly suggest that thermal sensation is represented in insular cortex, an area usually associated with autonomic and limbic function9–11. Functional anatomy in monkeys 184
indicates that a dedicated thalamic nucleus relays topographic, discriminative thermoreceptive-specific and nociceptive-specific lamina I spino- and trigeminothalamic projections to the dorsal margin of middle/posterior insular cortex2,12,13. Microstimulation seemingly localized to the homologous thalamic region in awake humans can produce discrete, graded sensations of cold14. Data from a PET imaging study of the thermal grill illusion of pain4 and an fMRI study14 indicate that strong innocuous cool stimulation (20°C) activates contralateral insular cortex, but not parietal somatosensory cortical areas. We used PET imaging of regional cerebral blood flow (rCBF) to examine changes in forebrain activity directly related to the intensity of graded cooling stimuli. Our results demonstrate that discriminative thermosensory cortex lies in the dorsal margin of the middle/posterior insula of humans.
RESULTS We addressed the hypothesis that thermal stimuli activate the contralateral insular cortex by examining rCBF changes with graded cooling of the right hand. Tonic thermal stimuli were used, because the tonic responses of thermoreceptive-specific lamina I neurons linearly encode innocuous cool temperatures, whereas their dynamic responses saturate more quickly1,15,16. Thus, the stimuli ramped slowly downward and achieved a stable target temperature 15 seconds before scan initiation. Preliminary testing verified the discriminability of these stimuli and the stability of the evoked sensations over the 45–60-second stimulation period1. Using a verbal, open-ended zero to ten scale for magnitude estimation of cold intensity, all volunteers were able to differentiate stimuli that differed by 2°C in ascending or descending sequences, and their ratings were correlated with stimulus intensity (Fig. 1a). We first explored changes in regional activity over the entire forebrain by examining differences (subtractions) between the various thermal stimulus conditions (30°C, 28°C, 26°C, 24°C, 20°C) nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
a
Ratings
Activity
c
Temperature (°C)
Activity
© 2000 Nature America Inc. • http://neurosci.nature.com
b
Temperature (°C)
Fig. 1. Regression plots. (a) Average ratings given by the volunteers for the thermal stimuli during the PET scans (r = 0.83; p < 10–6). (b) Average rCBF activity in left (contralateral) insular cortex (coordinates = –36, –22, 24; r = –0.55; p < 0.00005). (c) Step-like shift of average rCBF activity in right posterior parietal cortex (coordinates = 36, –40, 36). Bars indicate standard error.
sion, but there were obvious shifts in magnitudes and spatial extents. The largest correlations with ratings were located in the right orbitofrontal and anterior insular regions (Table 2; Fig. 2). A significant correlation was seen in the left anterior insula (Fig. 2, 24 mm), where there had been little correlation with stimulus temperature. In contrast, the correlations in posterior parietal cortex were greatly reduced. Surprisingly, the extent of the correlated activation in the upper brainstem increased (Fig. 2, –16 mm). Upon closer examination, we noted that the correlations with stimulus intensity in left middle/posterior and right anterior insular cortex had equal strength. However, the correlation with ratings was significantly stronger in right anterior insula than in left middle/posterior insula (F-test, F1,116 = 4.61, p < 0.034; Fig. 3). The correlation in right anterior insula with ratings was marginally better than with temperature (F = 2.1887, p < 0.07, one-tailed). Similarly, activation in right orbitofrontal cortex was better correlated with ratings than with temperature (F = 40.3478, p < 10–8). Given the close correspondence of the ratings with stimulus intensity, these are substantial differences. The significance of these correlations with ratings was confirmed by ANCOVA with effects due to temperature, intersubject variability and scan-session factored out (right anterior insula, z = 2.95, p < 0.003; right orbitofrontal, z = 3.59, p < 0.0002). Thus activation on the right (nondominant) side in the anterior insula and orbitofrontal regions (and also left anterior insula) was related to subjective evaluation of the thermal stimuli. In contrast, the activation in right and left posterior parietal cortices was significantly greater during all thermal stimuli than
and the baseline condition (33°C) and averaging across subjects. For example, we found that the 20°C stimulus produced significant rCBF increases on the left (contralateral) side in the middle/posterior insular region, the adjacent lentiform nuclei, posterior parietal cortex and middle cingulate cortex and on the right (ipsilateral) side in the region of the anterior insula, lentiform nuclei, posterior parietal cortex and orbitofrontal cortex (Fig. 2). There was slight activation in the middle/upper brainstem, probably representing the periaqueductal gray and the parabrachial nucleus5. The extent of activation in several regions seemed smaller with less intense cooling stimuli, so we proceeded to correlational analyses. We used a voxel-by-voxel regression analysis to explore correlations between the intensity of thermal stimulation and regional activity over the entire forebrain, testing the hypotheses that there would be significant correlations in the left insular region and the other regions noted above. In the left forebrain, rCBF was strongly correlated with stimulus intensity in the middle/posterior insular region (Fig. 2). There was a weak correlation in left posterior parietal cortex (but see below). Significant correlations were observed on the right side in the anterior insular/lentiform, posterior parietal and orbitofrontal regions and middle/upper brainstem. The rCBF correlation with stimulus intensity in the left mid- Table 1. Regression with stimulus temperature. dle/posterior insula was highly significant and Site Coordinates (x, y, z) Peak Z r Slope p was the largest in the entire forebrain L. post. insula –36 –22 24 4.26 –0.55 –0.11 0.00005 (p < 0.00005; Fig. 1b; Table 1). We interpret R. ant. insula 32 12 20 4.12 –0.51 –0.16 0.00004 this region as the contralateral cortical reprebrainstem 10 –32 –16 2.93 –0.38 –0.10 0.002 sentation of discriminative thermal sensation. 36 –40 36 4.12 –0.47 –0.12 0.00008 We next examined correlations between the R. post. parietal 24 38 0 3.72 –0.43 –0.12 0.0004 volunteers’ subjective ratings of thermal stimu- R. orbitofrontal lus intensity and rCBF activity in these regions, Results for the regression against stimulus temperature in the identified regions. Stereotaxic again using a voxel-by-voxel regression analysis. (Talairach) coordinates are given as x, mediolateral; y, anteroposterior; z, horizontal. The peak Z As expected, correlations were found in most of value is given for the single voxel at the focus, and the regression values encompass a region extendthe same regions as with the temperature regres- ing ±2 voxels in each direction around the focus (±1 voxel for the brainstem site). L., left; R., right. nature neuroscience • volume 3 no 2 • february 2000
185
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
in the baseline condition (t-test, p < 10–5, right Table 2. Regression with raw ratings. and left), but nearly uniform (ANOVA; right, Coordinates (x, y, z) Peak Z r Slope p F 4,45 = 0.9767, p > 0.42; left, F = 0.4584, Site L. post. insula –36 –22 24 3.54 0.52 0.13 0.0006 p > 0.77; Fig. 1c). Thus, we interpret these 32 12 20 4.69 0.60 0.24 0.000004 step-like increases in parietal activation as R. ant. insula 10 –32 –16 2.90 0.41 0.18 0.002 related to the attention directed to the right Brainstem R. post. parietal 36 –40 36 2.69 0.47 0.16 0.0005 hand during the thermal stimuli. Frontal projection showed that graded ther- R. orbitofrontal 24 38 0 4.80 0.57 0.21 0.000005 mal activation in the left (contralateral) middle/posterior insula was focused at the dorsal Results for the regression against subjects’ ratings in the identified regions. Conventions as in Table 1. margin (Fig. 4). Notably, because it was centered in the fundus of the superior limiting (circular) sulcus, the associgin of the middle/posterior insula. The activation was linearly ation of this site with insular cortex might not be appreciated if it correlated with stimulus intensity, indicating that this site reprewere viewed only in an axial (horizontal) projection. The localizasents discriminative thermal sensation. The demonstration that tion of the foci of activation correlated with the subjects’ ratings in human thermosensory cortex is located in insular cortex, rather the right (ipsilateral) anterior insular and orbitofrontal regions is than in parietal somatosensory areas, is significant for several shown in Fig. 5. reasons. This directly confirms the prediction of several comparative and clinical observations, it substantiates the key perDISCUSSION spective that thermal sensation is a specific aspect of We found highly significant activation with innocuous cooling enteroception, and it provides strong evidence for the proposal stimuli at one site in the contralateral forebrain, the dorsal marthat central pain is an integrative thermosensory disorder. Innocuous primary afferent (Aδ ‘cool’ and C ‘warm’) thermoreceptors innervating skin and deep tissues terminate in the superficial spinal (and 20° – 33° trigeminal) dorsal horn, where a unique population of lamina I spinothalamic neurons is thermoreceptive-specific and morphologically distinct16–19. These neurons have thresholds near normal skin Temp. regr. temperature, evince linearly graded responses to innocuous cooling and have ongoing discharge that is inhibited by warming and activity that is correlated with discriminative thermal senRating sation15,16. (Neurons selectively excited regr. by warm are also present, though relatively rare.) They project to thalamus in the crossed lateral spinothalamic tract, 40 mm 32 mm 28 mm 24 mm 20 mm 16 mm which is clinically and behaviorally critical for temperature sensibility, as well as for pain, itch and sexual sensations20–22. In primates, lamina I neurons 20° – 33° terminate in a dedicated thalamic relay nucleus (VMpo, the posterior part of the ventral medial nucleus), which contains thermoreceptive- and nociceptivespecific neurons2,12. In awake humans, Temp. such neurons seem to be located in the regr. same region, where microstimulation produces sensations of graded cold or pain14,23,24. The homologous pathway exists in cats and rats in primordial form; VMpo is visible only in primates, Rating and it is proportionately greatly regr. enlarged in humans12. Anatomic data in monkeys indicate that VMpo projects topographically to a cytoarchitectoni12 mm 8 mm 0 mm –8 mm –16 mm –20 mm cally distinct field in the fundus of the Fig. 2. Comparison of the statistical maps of rCBF activation for three different analyses at 12 of the 18 axial levels examined. Abbreviations: 20° – 33°, subtraction comparing activation in the 20°C stimulus with the superior limiting sulcus at the dorsal baseline 33°C condition; Temp. regr., correlation with stimulus temperature; Rating regr., correlation with margin of middle/posterior insular corsubjects’ ratings. The yellow area indicates activation significant at the z > 2.58 level (p < 0.005), and the red tex5,13. This location matches the site of area indicates activation significant at the z > 3.90 level (p < 0.0001). Numbers indicate axial (horizontal) level. the human thermosensory cortex 186
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Percent activity
Left insula
Percent activity
© 2000 Nature America Inc. • http://neurosci.nature.com
Right insula
Ratings
Fig. 3. Regression plots comparing the proportional rCBF increases with ratings in left posterior insula (slope against absolute rCBF = 0.13) and right anterior insula (slope against absolute rCBF = 0.24) for each subject at each temperature.
demonstrated by the present observations. We conclude that this site is the terminus of the lamina I spinothalamocortical pathway in humans. Together, these findings demonstrate the central pathway for discriminative thermal sensation. This observation explains available clinical findings. Contralateral thermosensory deficits are caused by lesions involving the lateral spinothalamic tract, posterolateral thalamus or parieto-insular cortex6,8,21,25. The critical cortical region is focused at the site identified by our observations. In contrast, lesions of parietal somatosensory areas have little or no effect on thermal (or pain) sensation1,25,26. Similarly, nearly all cooling-sensitive cells recorded in parietal somatosensory areas show nonlinear sensitivity associated with the cross-modal responsiveness of slowly adapting mechanore-
Fig. 4. Localization of thermosensory cortex in the dorsal margin of left (contralateral) insular cortex (coordinates = –36, –22, 24), identified by regression analysis of rCBF activation with stimulus temperature, in frontal, axial and sagittal views. The low cutoff (purple) of the spectral display is at z > 2.58 (p < 0.005), and the white indicates z > 3.90 (p < 0.0001). Note that in the axial view, this site seems parietal simply because the insula cannot be seen. The activation in right anterior insula is also visible in the axial view. These color-coded images were produced with the program Register (David MacDonald, Montreal Neurological Institute). nature neuroscience • volume 3 no 2 • february 2000
ceptors1,22. On the premise that temperature is an exteroceptive sensation, prior investigators sought thermoreceptive-specific neurons within the somatosensory system, and the homeostatic aspect of thermoreception was relegated to the brainstem and hypothalamus1. Our findings substantiate a different perspective. Our findings fit the concept that temperature sensation is a specific, emergent aspect of enteroception. Like all ‘feelings’ from the body, but in contrast to exteroceptive (touch) and teloreceptive (vision) modalities, thermal sensibility is inherently endowed with a characteristic affect that motivates behavior, and it reflexively generates autonomic responses that signal its primary role in thermoregulation and its integration with homeostasis. The functional anatomical characteristics of lamina I and insular cortex manifest this perspective (reviewed in ref. 5). Small-diameter afferents that terminate in lamina I originate from nearly all tissues of the body and are sensitive to changes in physiological conditions that require systemic responses (for example, temperature, strong mechanical strain, exercise, low pH, hypoglycemia, hypoxia, hypo-osmolarity, histamine or inflammatory mediators). Consonantly, lamina I has major projections to spinal autonomic and brainstem homeostatic integration sites, including regions that receive convergent vagal afferent activity and are heavily interconnected with the hypothalamus and amygdala, namely, the parabrachial nucleus (PB), periaqueductal gray (PAG) and the A1 cell group. Lamina I also receives descending modulation directly from brainstem pre-autonomic sources (A5, A7, raphe) and from the hypothalamus. These and other considerations indicate that the fundamental role of lamina I is to distribute modality-selective sensory information on the ongoing physiological status of the tissues of the body to a hierarchical network involved in the maintenance of the integrity (or well-being) of the organism5. The termination of the ascending lamina I pathway in insular cortex is thus consistent with the view of the insula as limbic sensory cortex, which is based on its association with visceral
Temperature regression, left middle posterior insula (–36, –22, 24)
187
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
Rating regression, right anterior insula (32, 12, 20)
Rating regression, right orbitofrontal (24, 38, 0)
Fig. 5. Localization of the evaluative regions in right anterior insular and orbitofrontal cortices, identified by regression analysis of rCBF activation with subjects’ ratings, in frontal, axial and sagittal views. Conventions as in Fig. 3.
and autonomic function, its multimodal features and, particularly, its strong interconnections with hypothalamus, amygdala and cingulate and orbitofrontal cortices9–11. Descending projections from insular cortex terminate in lamina I as well as in the same brainstem pre-autonomic and homeostatic sites noted above27. Stimulation or lesions of insular cortex affect cardiorespiratory, gastrointestinal, sympathetic and thermoregulatory activity11. In primates, the VMpo projection to the dorsal margin of the insula is contiguous anteriorly with the region that receives general (vagal) and special (gustatory) visceral input by way of the thalamic VMb nucleus (which is contiguous with VMpo)27,28. The common source of ascending input to insular cortex (by way of VMb) in all mammals is the parabrachial nucleus, the brainstem homeostatic site that integrates both vagal and lamina I inputs; accordingly, the primordial role of insular cortex can be regarded as modulation of PB and as a source of multimodal input to goal-directed, homeostatic motor processing in the hypothalamus, amygdala and other sites10,11,29. Consonant with the enormous encephalization in primates, especially humans, primate enteroceptive sensory inputs bypass PB, with a direct gustatory projection from the solitary nucleus to VMb30 and a topographic, dedicated lamina I projection to VMpo. These pathways seem to provide a highly resolved enteroceptive representation of the body’s condition in humans, including the specific sensations of temperature, pain and other ‘feelings’ from the body. Many observations from functional imaging reinforce these considerations. Middle/posterior insular activation is observed with gustatory stimulation (taste), fasting (hunger), hypertonic saline injection (thirst and, perhaps, induced hyperthermia), lactate injection (tachycardia and panic in inducible patients), cholecystokinin injection (tachycardia and induced anxiety), inspiration, isometric exercise and various types of cutaneous and deep pain4,31–38. All of these can be considered aspects of primary enteroceptive sensation. A broader association of anterior insula with internally generated emotion is suggested by its activation with recall-generated sadness, anticipatory anxiety, panic, disgust and visually 188
evoked sexual arousal35,39–41. Consistent with our association of right anterior insular activity with thermosensory evaluation, similar activation is observed with the signaled anticipation of heat pain42 and with tonically evoked heat pain38, in addition to contralateral middle/posterior insular activation that can be ascribed to the lamina I spinothalamocortical projection from VMpo. Thus, these findings are consistent with the neurological hypothesis that the right (nondominant) anterior insula is integral to mentally generating the image of one’s physical state that underlies basic emotions43, an essential part of the ‘somatic marker’ hypothesis of consciousness, or in different words, a limbic sensory substrate involved in the evaluation that invests internal feelings with emotional significance35. Our findings suggest that perceptual dissociation of the affect generated by a thermal stimulus, which depends on thermoregulatory integration, from the discriminative aspect, which does not44, could occur upon contextual evaluation in the right anterior insula, and further in the orbitofrontal cortex2,45. Nonetheless, whereas thermal sensation (like ticklish or sensual feelings) can be either pleasant or unpleasant, thermal distress is selectively associated with concomitant activation of the anterior cingulate, that is, limbic motor cortex4. The location of human thermosensory cortex corresponds unmistakably with the critical cortical region damaged in certain post-stroke central pain patients8, consistent with the proposal that disruption of thermal sensation may cause central pain5. Head and Holmes recognized that central pain is released by loss of a specific pain and temperature pathway25, but inferred that discriminative pain processing normally inhibits the emotional aspect of pain. Others suggest that loss of the lateral pain pathway releases a hypothetical spinoreticulothalamic pathway or that deafferentation causes bursting and hyperactivity in somatosensory pathways7. However, clinical observers report high correlation of ongoing, burning central pain with the loss of thermal sensibility6. Analyses of peripheral nerve block3 and of the thermal grill illusion of pain reveal that reduced thermosensory (cool) activity disinhibits a painful burning sensation. In particular, the thermal grill, in which a sensation of burning, ice-like pain is generated by innocuous cool (20°C) and warm (40°C) stimuli nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
presented together in a spatially unusual fashion, demonstrates that reduced activity in the cooling-sensitive lamina I spinothalamocortical pathway unmasks polymodal nociceptive activation of the anterior cingulate cortex that is selectively associated with thermal pain4,15. The intense burning experienced when warm water is applied to a foot numbed by cold is directly comparable to the thermal grill sensation and is an exigent thermoregulatory distress signal. Cutaneous cooling inhibits various enteroceptive ‘feelings’; one normal function of the ‘cold inhibition of pain’ may be to produce graded (integrated) differentiation of noxious (stressful) cold from innocuous cool, thereby motivating appropriate homeostatic responses to thermal distress that requires protective behavior. Thus, the thermosensory disinhibition hypothesis proposes that disruption of the thermosensory (enteroceptive) area in insular cortex disinhibits a limbic network, involving brainstem homeostatic sites (PB, PAG) and anterior cingulate cortex, that engenders affect associated with thermoregulatory motivation5. The affective ‘feeling’ associated with a thermal stimulus reflects the needs of thermoregulatory integration44 and seems to persist following thalamocortical thermosensory lesions22. Vague autonomic disturbances are repeatedly noted in central pain patients, and many experience relief simply by going into a warm room, exercising lightly or sitting in a spa6,25. The present results provide strong evidence supporting the idea that central pain is an enteroceptive, thermoregulatory dysfunction.
METHODS Our protocol was approved by local institutional review boards. We measured rCBF during 12 scans (60 s each) in each of 10 normal right-handed volunteers (3 female, 7 male; ages 23–49, mean 33) using an ECAT 951/31 scanner (CTI, Knoxville, Tennessee). After a 30-min transmission scan, bolus injections of 40 mCi of H215O were made at 15-min intervals4. Thermal stimuli were applied to the palmar surface of the right hand with a 20 × 14 cm feedback-controlled Peltier device4,15. The volunteers had received similar, but not identical, stimuli before the scans. The cooling stimuli ramped at 1° per s from a baseline of 33°C and attained a stable plateau temperature of 30, 28, 26, 24 or 20°C before each bolus injection, whereas the neutral condition remained at 33°C. Each volunteer was instructed to remain still with eyes closed. Scanning was initiated upon the sharp increase in measured radioactivity (15–18 seconds after the injection). The temperature was stable through the first 30 s of the scan and then returned to baseline (ramp rate, 10° per s), to maximize the contrast between state-dependent rCBF increases and noise46. The volunteers gave a magnitude estimate of the perceived intensity of cold following each scan using an open-ended scale of zero to ten. The six different stimulus conditions were presented two times each, first in a descending sequence of temperatures and then in an ascending sequence, to counterbalance order effects. The scanner produced 31 horizontal 128 × 128 slices with a separation of 3.375 mm, a 10.8-cm axial field of view, an in-plane resolution of 9.5 mm, full width at half maximum (FWHM) and an axial resolution of 5.0–7.1 mm FWHM. The data were analyzed with Statistical Parametric Mapping (SPM96) implemented in Matlab (Mathworks, Sherborn Massachusetts)47,48. The PET images for each subject were aligned with the initial scan49, transformed into a standard stereotaxic coordinate space50, smoothed with an isotropic Gaussian kernel (16 mm FWHM) and normalized for global variations in absolute measurements. Statistical parametric maps were constructed using data from all ten volunteers and superimposed onto a spatially standardized MRI volume. The statistical comparisons between different stimulus conditions and the regression analyses were performed at each voxel using a multi-subject design with replications. Normalized t-values (z-scores) were computed to compare differences between each active thermal condition and the neutral condition and for regressions against temperature and magnitude ratings. Significant rCBF activation in the regions of interest occurred at z > 2.58, yielding p < 0.005 uncorrected for multiple comparisons35,38. nature neuroscience • volume 3 no 2 • february 2000
ACKNOWLEDGEMENTS We thank S. Goodwin, J. Frost and D. Andrew for technical assistance. This study was supported by the Robert S. Flinn Foundation and the Atkinson Pain Research Fund administered by the Barrow Neurological Foundation.
RECEIVED 8 OCTOBER; ACCEPTED 6 DECEMBER 1999 1. Darian-Smith, I. in Handbook of Physiology, Section 1, The Nervous System, Vol. III, Sensory Processes (ed. Darian-Smith, I.) 879–913 (American Physiological Society, Bethesda, 1984). 2. Craig, A. D., Zhang, E. T. & Blomqvist, A. A distinct thermoreceptive subregion of lamina I in nucleus caudalis of the owl monkey. J. Comp. Neurol. 404, 221–234 (1999). 3. Yarnitsky, D. & Ochoa, J. L. Release of cold-induced burning pain by block of cold-specific afferent input. Brain 113, 893–902 (1990). 4. Craig, A. D., Reiman, E. M., Evans, A. & Bushnell, M. C. Functional imaging of an illusion of pain. Nature 384, 258–260 (1996). 5. Craig, A. D. A new version of the thalamic disinhibition hypothesis of central pain. Pain Forum 7, 1–14 (1998). 6. Boivie, J., Leijon, G. & Johansson, I. Central post-stroke pain—A study of the mechanisms through analyses of the sensory abnormalities. Pain 37, 173–185 (1989). 7. Pagni, C. A. Central Pain: A Neurosurgical Challenge. (Ediziona Minerva Medica S. P. A., Turin, 1998). 8. Schmahmann, J. D. & Leifer, D. Parietal pseudothalamic pain syndrome: Clinical features and anatomic correlates. Arch. Neurol. 49, 1032–1037 (1992). 9. Mesulam, M.-M. & Mufson, E. J. Insula of the old world monkey. III: Efferent cortical output and comments on function. J. Comp. Neurol. 212, 38–52 (1982). 10. Allen, G. V., Saper, C. B., Hurley, K. M. & Cechetto, D. F. Organization of visceral and limbic connections in the insular cortex of the rat. J. Comp. Neurol. 311, 1–16 (1991). 11. Augustine, J. R. Circuitry and functional aspects of the insular lobe in primates including humans. Brain Res. Rev. 22, 229–244 (1996). 12. Craig, A. D., Bushnell, M. C., Zhang, E.-T. & Blomqvist, A. A thalamic nucleus specific for pain and temperature sensation. Nature 372, 770–773 (1994). 13. Craig, A. D. in Forebrain Areas Involved in Pain Processing. (eds. Besson, J.-M., Guilbaud, G. & Ollat, H.) 13–26 (John Libbey, Paris, 1995). 14. Davis, K. D. et al. Thalamic relay site for cold perception in humans. J. Neurophysiol. 81, 1970–1973 (1999). 15. Craig, A. D. & Bushnell, M. C. The thermal grill illusion: unmasking the burn of cold pain. Science 265, 252–255 (1994). 16. Dostrovsky, J. O. & Craig, A. D. Cooling-specific spinothalamic neurons in the monkey. J. Neurophysiol. 76, 3656–3665 (1996). 17. Christensen, B. N. & Perl, E. R. Spinal neurons specifically excited by noxious or thermal stimuli: marginal zone of the dorsal horn. J. Neurophysiol. 33, 293–307 (1970). 18. Dostrovsky, J. O. & Hellon, R. F. The representation of facial temperature in the caudal trigeminal nucleus of the cat. J. Physiol. (Lond.) 277, 29–47 (1978). 19. Han, Z.-S., Zhang, E.-T. & Craig, A. D. Nociceptive and thermoreceptive lamina I neurons are anatomically distinct. Nat. Neurosci. 1, 218–225 (1998). 20. White, J. C. & Sweet, W. H. Pain and the Neurosurgeon: A Forty-Year Experience 1000 (Thomas, Springfield, Massachusetts, 1969). 21. Norrsell, U. Behavioural thermosensitivity after unilateral, partial lesions of the lateral funiculus in the cervical spinal cord of the cat. Exp. Brain Res. 78, 369–373 (1989). 22. Norrsell, U. & Craig, A. D. Behavioral thermosensitivity after lesions of thalamic target areas of a thermosensory spinothalamic pathway in the cat. J. Neurophysiol. 82, 611–625 (1999). 23. Dostrovsky, J. O., Wells, F. E. B. & Tasker, R. R. in Processing and Inhibition of Nociceptive Information, International Congress Series 989 (eds. Inoka, R., Shigenaga, Y. & Tohyama, M.) 115–120 (Excerpta Medica, Amsterdam, 1992). 24. Lenz, F. A. et al. Neurons in the area of human thalamic nucleus ventralis caudalis respond to painful heat stimuli. Brain Res. 623, 235–240 (1993). 25. Head, H. & Holmes, G. Sensory disturbances from cerebral lesions. Brain 34, 102–254 (1911). 26. Adams, R. W. & Burke, D. Deficits of thermal sensation in patients with unilateral cerebral lesions. Electroencephalogr. Clin. Neurophysiol. 73, 443–452 (1989). 27. Yasui, Y., Breder, C. D., Saper, C. B. & Cechetto, D. F. Autonomic responses and efferent pathways from the insular cortex in the rat. J. Comp. Neurol. 303, 355–374 (1991). 28. Pritchard, T. C., Hamilton, R. B., Morse, J. R. & Norgren, R. Projections of thalamic gustatory and lingual areas in the monkey, Macaca fascicularis. J. Comp. Neurol. 244, 213–228 (1986). 29. Shi, C. J. & Cassell, M. D. Cortical, thalamic, and amygdaloid connections of the anterior and posterior insular cortices. J. Comp. Neurol. 399, 440–468 (1998).
189
© 2000 Nature America Inc. • http://neurosci.nature.com
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
30. Beckstead, R .M., Morse, J. R. & Norgren, R. The nucleus of the solitary tract in the monkey: projections to the thalamus and brain stem nuclei. J. Comp. Neurol. 190, 259–282 (1980). 31. Kinomura, S. et al. Functional anatomy of taste perception in the human brain studied with positron emission tomography. Brain Res. 659, 263–266 (1994). 32. Benkelfat, C. et al. Functional neuroanatomy of CCK4-induced anxiety in normal healthy volunteers. Am. J. Psychiatry 152, 1180–1184 (1995). 33. Casey, K. L., Minoshima, S., Morrow, T. J. & Koeppe, R. A. Comparison of human cerebral activation patterns during cutaneous warmth, heat pain, and deep cold pain. J. Neurophysiol. 76, 571–581 (1996). 34. King, A. B., Menon, R. S., Hachinski, V. & Cechetto, D. F. Human forebrain activation by visceral stimuli. J. Comp. Neurol. 413, 572–582 (1999). 35. Reiman, E. M. The application of positron emission tomography to the study of normal and pathological emotions. J. Clin. Psychiatry 58, 4–12 (1997). 36. Denton, D. et al. Neuroimaging of genesis and satiation of thirst and an interoceptor- driven theory of origins of primary consciousness. Proc. Natl. Acad. Sci. USA 96, 5304–5309 (1999). 37. Tataranni, P. A. et al. Neuroanatomical correlates of hunger and satiation in humans using positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 4569–4574 (1999). 38. Derbyshire, S. W. G. & Jones, A. K .P. Cerebral responses to a continual tonic pain stimulus measured using positron emission tomography. Pain 76, 127–135 (1998). 39. Stoleru, S. et al. Neuroanatomical correlates of visually evoked sexual arousal in human males. Arch. Sex. Behav. 28, 1–21 (1999). 40. Phillips, M. L. et al. A specific neural substrate for perceiving facial expressions of disgust. Nature 389, 495–498 (1997).
190
41. Mayberg, H. S. et al. Reciprocal limbic-cortical function and negative mood: converging PET findings in depression and normal sadness. Am. J. Psychiatry 156, 675–682 (1999). 42. Ploghaus, A. et al. Dissociating pain from its anticipation in the human brain. Science 284, 1979–1981 (1999). 43. Damasio, A. R. Descartes’ Error: Emotion, Reason, and the Human Brain 312 (Putnam, New York, 1993). 44. Mower, G. Perceived intensity of peripheral thermal stimuli is independent of internal body temperature. J. Comp. Physiol. Psychol. 90, 1152–1155 (1976). 45. Francis, S. et al. The representation of pleasant touch in the brain and its relationship with taste and olfactory areas. Neuroreport 10, 453–459 (1999). 46. Volkow, N. D., Mullani, N., Gould, L. K., Adler, S. S. & Gatley, S. J. Sensitivity of measurements of regional brain activation with oxygen-15-water and PET to time of stimulation and period of image reconstruction. J. Nucl. Med. 32, 58–61 (1991). 47. Friston, K. J., Frith, C. D., Liddle, P. F. & Frackowiak, R. S. Comparing functional (PET) images: the assessment of significant change. J. Cereb. Blood Flow Metab. 11, 690–699 (1991). 48. Worsley, K. J., Evans, A. C., Marrett, S. & Neelin, P. A three-dimensional statistical analysis for CBF activation studies in human brain. J. Cereb. Blood Flow Metab. 12, 900– 918 (1992). 49. Woods, R. P., Cherry, S. R. & Mazziotta, J. C. Rapid automated algorithm for aligning and reslicing PET images. J. Comput. Assist. Tomogr. 16, 620–633 (1992). 50. Talairach, J. & Tournoux, P. Co-Planar Stereotaxic Atlas of the Human Brain (Thieme, New York, 1988).
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Expertise for cars and birds recruits brain areas involved in face recognition Isabel Gauthier1,2, Pawel Skudlarski2, John C. Gore2 and Adam W. Anderson2 1
Present Address: Department of Psychology, Vanderbilt University, Wilson Hall, Nashville, Tennessee 37240, USA
2
Department of Diagnostic Radiology, Yale University Medical School, Fitkin Basement, 333 Cedar Street, New Haven, Connecticut 06510, USA
© 2000 Nature America Inc. • http://neurosci.nature.com
Correspondence should be addressed to I.G. (
[email protected])
Expertise with unfamiliar objects (‘greebles’) recruits face-selective areas in the fusiform gyrus (FFA) and occipital lobe (OFA). Here we extend this finding to other homogeneous categories. Bird and car experts were tested with functional magnetic resonance imaging during tasks with faces, familiar objects, cars and birds. Homogeneous categories activated the FFA more than familiar objects. Moreover, the right FFA and OFA showed significant expertise effects. An independent behavioral test of expertise predicted relative activation in the right FFA for birds versus cars within each group. The results suggest that level of categorization and expertise, rather than superficial properties of objects, determine the specialization of the FFA.
Face and object recognition differ in at least two ways. First, faces are recognized at a more specific level of categorization (for example, ‘Adam’) than most objects (for example, ‘chair’ or ‘car’). Second, although we are experts with faces, we have much less experience discriminating among members of other categories. Level of categorization and expertise are relevant even for unfamiliar faces and objects. A person passed on the street may be encoded at the individual level and recognized the next day, whereas a mug may be replaced by another mug without our noticing. Processing biases for different categories depend on our experience with levels of categorization and our expertise in extracting diagnostic features1. Viewing faces activates a small extrastriate region called the fusiform face area (FFA)2–10. Neuropsychological studies suggest that the brain areas responsible for face and object processing can be dissociated11–14. According to one view, extrastriate cortex contains a map of visual features15–16, suggesting that the same region should not be recruited for processing different object categories when the relevant features differ. On the other hand, prosopagnosia is often associated with deficits discriminating among nonface objects within categories. For example, a bird watcher became unable to identify birds17, whereas another patient could no longer identify car makes18. Thus, one hypothesis holds that prosopagnosia is a deficit in evoking a specific context from a stimulus belonging to a class of visually similar objects19. At least some prosopagnosic patients have difficulty with classes in which objects are both visually and semantically homogeneous20,21. Evidence from brain-lesion studies is still under debate13,22; however, additional data from brain imaging may help resolve these questions. Several lines of research converge to suggest that level of categorization and expertise account for a large part of the activation difference between faces and objects. First, behavioral effects23–25 once thought unique to faces have been obtained with objects, often with expert subjects26–29. Second, nonface objects elicit more nature neuroscience • volume 3 no 2 • february 2000
activation in the FFA when matched to specific labels as compared to more categorical ones (for example, ‘ketchup bottle’ versus ‘bottle’)3,30. Third, expertise with animal-like unfamiliar objects (‘greebles’) recruits the right FFA4. However, it remains unclear whether expertise with any homogeneous category is capable of recruiting the neural substrate of face recognition. This experiment had three purposes. First, we tested whether long-term expertise with birds and cars would recruit face-selective areas. Second, the interaction between level of categorization and expertise was investigated. Third, we tested how these two factors depend on attention to stimulus identity. The FFA typically activates more for faces than objects, even during passive viewing7. This suggests that faces are processed automatically at the subordinate level. Here we asked whether this is also true for other expertise domains.
RESULTS We tested 11 car experts and 8 bird experts with many years of experience recognizing car models or bird species (Table 1). The right and left FFA and right occipital face area (OFA) were defined in passive-viewing localizer scans (see Methods). The OFA is also face selective31 and active in greeble experts4. A right FFA was found in all subjects (median size, 6 voxels), a left FFA was found in 13 subjects (4 bird experts, 9 car experts; median size, 5 voxels) and a right OFA in 15 subjects (7 bird experts, 8 car experts; median size, 7 voxels). Subjects also underwent identity and location scans. Stimulus presentation was identical in both conditions, and subjects detected immediate (1-back) repetitions in either the identity of the picture or its location while ignoring the other dimension. Blocks of 16 grayscale faces, objects, cars or birds shown sequentially were alternated with periods of fixation (Fig. 1). Pilot experiments indicated that the absence of color cues did not eliminate the advantage of experts over novices. Behavioral data in the scanner was available for 16 of the 19 subjects. Performance was better in the identity 191
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
a
Location
b
Location or identity
Identity
Time
Fig. 1. Examples of stimuli and tasks for the fMRI protocol. (a) Images (256 × 256 pixels in size, 256 grays) from each of 4 categories (Caucasian faces without hair, passerine birds from New England, car models for the years 1995 and 1998 and various familiar objects) were used in the fMRI study. (b) Example of stimulus presentation during the fMRI runs. Subjects made 1-back repetition judgments regarding either location or identity (an identity repeat would show identical images, although sometimes in different locations—see Methods for details).
Inspection of Fig. 2 suggests baseline differences between categories and between groups. First, responses to birds were larger than to cars in FFAs of both hemispheres (right, F1,17 = 11.13, p < 0.05; left, F1,11 = 5.47, p < 0.05). Again, although animal faces may activate this area more than objects10, here we found no difference between cars and birds in novices. Bird experts showed more activation for any object category than car experts, although not significantly in any ROI. Given these baseline trends, it was crucial to measure the effect of expertise by comparing activation for cars and birds in the two groups. The predicted expertise effect was significant (a group × category interaction) in the right FFA (Figs. 2 and 3; F1,17 = 19.22, p < 0.0005) and in the right OFA (F1,13 = 4.86, p < 0.05). There was no expertise effect in the left FFA (F < 1). One important question is whether this expertise effect arises from the same area as face expertise. To test this, we used a set of criteria (see Methods) based on a definition of face cells in neurophysiology32. This defines a smaller FFA than any other definition to our knowledge (also eliminating the majority of OFA and left FFA ROIs, which were not analyzed further). We call this ROI the center of the FFA (median = 3 voxels), in which each voxel is highly face selective. Even in this ROI, both the level of categorization effect in novices (F1,17 = 6.37, p < 0.02) and the expertise effect were present (F1,17 = 10.25, p < 0.006; Fig. 3). These effects also held when analyzed in a subset of subjects whose FFA could be defined using described criteria6,10 (see supplemental material at http://neurosci.nature.com/web_specials/). To assess the magnitude of the expertise effect, we plotted the main effects and interaction separately for the center of the right FFA33 (Fig. 4). The statistically significant expertise effect contributed a difference of about 0.4% signal change between groups, whereas the group and category main effects contributed about 0.3% and 0.1% signal change, respectively, and were not significant (F < 1 for both). Corresponding values in the larger right FFA ROI were 0.2, 0.1 and 0.3, respectively. The expertise effect alone accounted for 32% of the difference between faces and objects in the right FFA defined at t = 2 and for 36% in the center of the right FFA. We measured the center of mass of the signal change for activated voxels for birds, cars and faces (relative to objects). This was done in a ROI of 25 × 25 voxels (each 1.3 mm by 1.7 mm, y × x over 3 slices in Talairach space, centered on the right and left FFA from the localizer). The only significant differences for cars or birds relative to faces were obtained in novice subjects
than the location runs (identity performance ± s.e., 89.4 ± 2.1; location, 86.0 ± 2.3; F1,14 = 9.98, p < 0.01) and this effect was larger for birds and objects than for cars and faces (task × category interaction, F1,14 = 5.86, p < 0.01). These categories varied more in shape, making location judgments more difficult. The percent signal changes in the three regions of interest (ROIs) were assessed using a fixation baseline. Table 1. Subject information and behavioral results. First, we describe all significant effects pooled across Bird experts task, coming back to this factor later. The level of cat- Mean age ± s.e. 34.4 ± 2.0 egorization effect was measured by comparing activa- Mean years experience ± se 18 ± 3.3 tion in novices to cars or birds versus objects. The effect of level of categorization was significant in the right FFA (F1,17 = 14.36, p < 0.02) and in the left FFA Behavioral data during fMRI (F1,11 = 8.76, p = 0.02.). This effect was marginal in the (% correct identity ± s.e.; location ± s.e.) 86 ± 3; 81 ± 4 right OFA (F1,13 = 3.67, p < 0.08). The interaction Objects 85 ± 3; 82 ± 3 between level and group was significant in both the Faces 84 ± 3; 81 ± 3 right FFA (F 1,17 = 6.61, p < 0.02) and the left FFA Cars (F1,11 = 6.47, p < 0.05). Post-hoc tests (p < 0.05) indi- Birds 87 ± 3; 81 ± 4 cated that the level effect was only significant for car experts viewing birds. It may be tempting to believe Behavioral data pre-test (d′ ± s.e.) that birds activate the FFA because of their faces10. Birds upright 2.53 ± 0.10 However, the difference between birds and cars for Cars upright 1.41 ± 0.12 novices was not significant in either area (p > 0.5 for Birds inverted 2.23 ± 0.20 both), and the group effect arises from a difference in Cars inverted 0.84 ± 0.13 activity for common objects (larger in birders). 192
Car experts 31 ± 2.5 20.6 ± 3.8
93 ± 3; 88 ± 3 92 ± 3; 91 ± 3 92 ± 2; 91 ± 2 92 ± 3; 89 ± 3
1.06 ± 0.07 2.42 ± 0.14 1.01 ± 0.09 1.58 ± 0.20
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
3.125 × 7 mm3) window in Fig. 5. Experts (and to some extent birdcar experts ers viewing cars) showed a distribution of activation for birds and Center of right FFA Right FFA cars that was relatively limited to the localizer peak of the FFA. The mean percent signal change in the center voxel was compared to that in the 8 voxels surrounding it, and to the surrounding ‘outside’ 16 voxels. An ANOVA (3 regions × 3 categories × 2 groups) revealed a main effect of region (F2,22 = 7.18, p < 0.004) with more activity in the center than in both outer regions. Because of greater activObjects Cars Birds Faces Objects Cars Birds Faces ity for faces than birds and cars only in the center, the category × region interaction was marginal Left FFA Right OFA (F4,44 = 2.18, p < 0.09), consistent with our other analyses. Crucially, there was no significant difference among the three categories in activity for each of the two surrounding regions, suggesting that activation is as focused for objects as for faces. As a more direct way of assessing the expertise effect, we measured the correlation between behavioral performance outside the scanner with the signal Objects Cars Birds Faces Objects Cars Birds Faces change in the three ROIs during Fig. 2. Mean percent signal change for each object category in the two expert groups in three face-specific ROIs the location and identity tasks. In and in the center of the right FFA. The average percent signal increase from fixation for each object category in the the behavioral test, subjects different ROIs was averaged across subjects in each ROI for each expert group. Error bars indicate standard error of the mean. The Talairach coordinates for the center of each ROI ± standard error were right FFA, x = 38 ± 2, judged whether sequentially prey = –50 ± 1, z = –7 ± 1; left FFA, x = –38 ± 2, y = –56 ± 4, z = –6 ± 2; right OFA, x = 40 ± 2, y = –75 ± 3, z = –3 ± 1. sented pairs of birds and cars (upright or inverted) belonged to the same species or car model. The expertise effect was significant (group × category interaction; Table 1), bird experts being (see Table 2). Center of mass for expert categories was indistinmore sensitive for birds than cars and vice versa for car experts guishable from that obtained for faces (even using a lenient sta(F1,17 = 59.40, p < 0.0001). The effect of orientation and interactistical test). We also compared the activation distribution in the right FFA for the three categories by averaging nonspatially tion of category with orientation were significant, with the inversmoothed individual maps, centered on the most face-selective sion effect stronger for cars than for birds (F1,17 = 14.27, p < voxel in the localizer. This is shown in a 5 × 5 voxel (each 3.125 × 0.002). Both groups were poorer with inverted than upright cars, Mean % signal change
Mean % signal change
Mean % signal change
Mean % signal change
Faces – objects
Car expert
Fig. 3. The right FFA shows an expertise effect for birds and cars. One axial oblique slice through the FFA for one expert for each category shows the t-maps obtained when comparing the activation for faces, cars and birds with the activation elicited by objects during the location 1-back runs. The voxels marked by white crosses indicate the right FFA and OFA as defined in the passive viewing runs for these two subjects. (In this car expert, the OFA was actually in the slice immediately below and is shown on the same slice as the FFA only to illustrate its in-plane location.) Note that the center of the right FFA may be slightly different depending on the task (here passive viewing versus 1-back location) and that its size varies between subjects.
Bird expert
© 2000 Nature America Inc. • http://neurosci.nature.com
bird experts
nature neuroscience • volume 3 no 2 • february 2000
Cars – objects
Birds – objects
t = 4.5
t=1
193
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
194
Percent signal change
Percent signal change
bird experts whereas the inversion effect for birds only approached statistical significance in birdcar experts Main effects Interaction ers (p = 0.068). A group analysis was performed on the fMRI data during all 1-back tasks with cars and birds (see Methods). This less precise analysis allowed us to seek other regions showing an expertise effect regardless of the category, beyond the ones we could define functionally. This showed an area in right ventral temporal cortex that was more activated in experts than novices (Fig. 6). In addition to this stream of activation, going from the right OFA toward the right FFA, a bilateral region in the parahippocampal gyrus was Cars Birds Cars Birds also more active in experts. This area overlaps with the parahippocampal place Fig. 4. Main effects with grand mean and interaction partialed out and interaction effect with the area (PPA)34, functionally defined as the grand mean and main effects partialed out, in the center of the right FFA. Each observed condition region responding more to scenes than mean can be reconstructed by adding the value for the main effects and the interaction effect to the objects. (It also responds more to objects grand mean (in this case, 0.845). than faces.) Further work will be required to identify the role of this area in perceptual expertise. The only region more activated in novices than experts was a small bilateral area of the small (1-back identity versus passive viewing; but see ref. 36). We lateral occipital gyrus, superior to the OFA. This area has been also found no effect of task on the advantage of faces over objects in found to activate more for letter strings than faces35, and its selecthe right FFA (p > 0.28), nor on the expertise effect. Expertise may influence how objects are automatically processed, an idea that we tive activation for novices could reflect a switch from a featural come back to in our discussion. to a more configural strategy. In each ROI, we correlated the percent signal change for birds minus cars with relative expertise, the difference in sensitivity DISCUSSION (d′) for upright birds minus upright cars. As the 2 groups comPrevious studies suggest that level of categorization and expertise bined would produce a bimodal distribution, the correlation coefcontribute to the specialization of the FFA. The present results show ficients were calculated for each group separately using our largest how their contributions add up to account for a considerable part homogeneous sample (the 12 subjects scanned with axial slices.) of the difference typically found between objects and faces. For both groups, relative expertise was positively correlated with In our experiment, experts would know more names for the relative percent signal change for birds versus cars in the right birds or cars than novices would. However, naming is not likely FFA and only for the location task (car experts, r = 0.75; bird to account for the effects in the FFA because unfamiliar faces experts, r = 0.82; p < 0.05 for both; Fig. 7). activated this area the most, whereas common objects that are We also considered task effects beyond that found in the correeasily named elicited the least activation. In addition, expertise lation analyses. The only ROI showing a significant influence of effects for novel objects can be obtained in the FFA for unfatask was the right FFA, where this factor interacted with level of catmiliar exemplars of a trained category4. egorization (F1,17 = 6.58, p < 0.02): the subordinate-level advantage Why would faces recruit the FFA more than expert recognition of objects? There are many possibilities. First, the FFA was larger when novices attended to the identity than to the location may be dedicated to face recognition (innately or through expeof the stimuli. In prior studies6,10, the effect of task in the FFA was rience), although it may mediate the processing of Table 2. Center of mass coordinates in the middle temporal lobe for other objects to some extent. At the least, our study category-selective areas, given in Talairach coordinates. demonstrates that an innate bias is unnecessary for objects to recruit this area with expertise. Second, Left hemisphere Right hemisphere we cannot claim to have equated objects with faces x y z x y z on level of categorization and expertise22. The faces Bird experts may constitute a more visually homogeneous set Faces –31.3 –49.8 –7.6 40.8 –48.2 –8.5 than our bird or car images. Faces are recognized Cars –29.3* –47.3* –7.8 39.9 –47.5 –9.0 as individual exemplars, whereas even experts Birds –30.8 –49.6 –7.9 40.3 –48.1 –8.3 mainly recognize cars and birds at the model/species level. Although our subjects had Car experts years of experience with cars or birds, they still had been practicing face recognition for many more Faces –29.0 –48.7 –9.1 38.6 –48.1 –9.1 years. Thus, face recognition being in a sense ‘more Cars –28.9 –49.2 –8.1 38.3 –47.2 –8.5 subordinate’ and relying on ‘greater expertise’ may Birds –30.5* –49.8 –7.0 41.2* –47.8 –8.9 be what make it seem ‘special’, leaving little contri*Value significantly different from the coordinate for faces in the same expert group accordbution for a component of object category per se. ing to a least significant difference test; p < 0.05. Additionally, categorization level and expertise may
nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
Mean % signal change 0
Birds – objects
1.8
Cars – objects
Bird experts
Faces – objects
0.9
be only two of several factors that determine the specialization of this area. (Other factors may include symmetry, properties of associated semantic knowledge, number of exemplars, value to the perceiver37.) The effect obtained in the right OFA suggests that expertise may be responsible for specialization of a large part of the face recognition system (at least in the right hemisphere). In the left FFA, we found an effect of level of categorization, with no detectable contribution of expertise. Whereas subordinate-level processing may recruit both hemispheres, here visual expert recognition of homogeneous categories seems to be mainly a right hemisphere process. Our most striking result may be a very strong correlation between a behavioral test of object expertise and the relative activation in the right FFA for birds and cars. It is remarkable that the expertise of a subject was so accurately predicted from the activation in a small part (six voxels) of the brain, especially as the behavioral and fMRI experiments shared neither a common task nor stimulus set. In addition, this analysis suggests that activation of the right FFA was more directly correlated with expert performance than the right OFA. Car experts
© 2000 Nature America Inc. • http://neurosci.nature.com
Fig. 5. Spatial distribution of percent signal change for faces, birds and cars (relative to an objects baseline) in a 5 × 5 voxel window in the right FFA, centered on the most strongly activated voxel in the localizer. Dashed lines indicate the three regions within which activation was averaged for analyses. Note that the highest activation during experimental runs for faces may not be identical to the highest peak in the localizer (consider car experts in the faces – objects condition).
There seems to be an important interaction between automaticity of processing at the subordinate level and expertise. It is argued that the preference of the FFA for faces does not depend on the task6,10 (but see ref. 35), a claim also supported by our results. However, we found an interaction between level of categorization and task for novices, indicating that, for most people, simply seeing an object among similar exemplars may not prompt complete subordinate-level processing. Automatic subordinate-level processing for experts could also explain a surprising finding: the correlation between behavior and activation in the right FFA was significant only when subjects attended to the location of the objects. During the identity task, subjects had to perform subordinate-level recognition with both categories, regardless of expertise. Novices may
Fig. 6. Expertise effect in the temporal cortex. The t-maps for all subjects with axial slices (14) were transformed into a common standard space. Voxels showing a significant expertise effect across subjects (p < 0.01) are displayed on the transformed anatomical images for slices 2 to 5 for a single subject. The red to yellow voxels were more active for experts than novices across the identity and location tasks, whereas the blue voxels were more active for novices. The right hemisphere is shown on the left. The FFA is typically found in slice three. nature neuroscience • volume 3 no 2 • february 2000
195
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
tral pathway, because it suggests that responses of neurons in extrastriate cortex may not be organized according to the visual features that they detect15,16; rather, their functional organization may depend on the different processes important for object recognition. For instance, some areas may be more suited for featural processing, whereas other areas may support configural and holistic processing, hallmarks of subordinatelevel expertise. Our results suggest that expert subordinate-level recognition for any category may be mediated in the same regions, either by virtue of activating common cells or through selectively activating different populations that are intermingled. Other techniques, such as single-cell recording, will be necessary to distinguish between these two alternatives.
Relative % signal change
car advantage
bird advantage
Location task
car experts, r = 0.75* bird experts, r = 0.82*
METHODS
bird advantage
Stimuli. One hundred and seventy six images each of passerine birds and cars were obtained from public sources on the world-wide web. Images were converted to 8-bit grayscale 256 × 256-pixel format, and objects were isolated and placed on a 50% gray background. Objects were selected to be familiar to our expert population. For each category, 112 images were used in the behavioral test, whereas the remaining 64 objects from each category were used for experimental scans. Faces without hair (n = 64, scanned in a 3-D laser scanner, courtesy of Niko Troje and Heinrich Bülthoff, Max Planck Institute, Tübingen, Germany) and 64 images of non-living familiar objects were prepared in the same way as the cars and birds and also used in experimental scans. Localizer scans used 90 grayscale photographs of faces and 90 pictures of familiar objects.
car experts, r = 0.10 bird experts, r = 0.004 Relative % signal change
bird advantage
Identity task
car advantage
© 2000 Nature America Inc. • http://neurosci.nature.com
Relative expertise (d′) car advantage
Relative expertise (d′) car advantage
bird advantage
Fig. 7. Relationship between a behavioral measure of expertise and activation in the right FFA. Relative expertise is the sensitivity (d′) for bird minus car matching. The dashed and full lines respectively indicate the best linear fits for car and bird experts. Significant correlation coefficients are marked with an asterisk (p < 0.05).
then use a featural strategy, whereas experts may use a more configural strategy26–28. Perhaps only configural processing is a good predictor of behavioral expertise. In contrast, during the location task novices may not access the subordinate level, whereas experts did so automatically. Birds and cars differ in many aspects. (Birds are small animals with moveable parts, covered with feathers that have specific markings; cars are large man-made objects made of metal and typically uniform in texture.) Combined with a previous study showing an expertise effect in the FFA with ‘greebles’4, our results suggest very few constraints on the structure of the objects for which expertise can recruit this small area. This is important for any theory of visual representation in the ven196
Subjects. Subjects, all male, included 11 car experts and 8 bird experts. Informed consent was obtained from each subject, and the study was approved by the Human Investigation Committee at the School of Medicine, Yale University. Eight subjects were left handed. Handedness did not correlate with any effect reported here.
Behavioral task. Each subject performed 10 blocks of 56 sequential matching trials, alternating between blocks showing birds or cars. There were four conditions (upright and inverted cars and birds). Each trial showed two images from the same category and orientation. Upright and inverted trials were randomly intermixed. On each trial, a fixation cross appeared for 500 ms, followed by stimulus 1 for 1000 ms and a pattern mask for 500 ms before stimulus 2 appeared and remained on the screen until a response was made. Subjects judged whether the two images showed birds from the same species or whether cars were from the same model but different years (mostly 1995 versus 1998). No difference was found in mean sensitivity between categories for novices. However, responses to cars were slower than responses to birds for all subjects (RTs for hits with cars, 1138 ms; birds, 1046 ms; p < 0.05, suggesting that the cars were more difficult). fMRI task. Experimental scans consisted of three runs of a one-back location task alternated with three runs of a one-back identity task. The only difference between identity and location runs was instructions to detect immediate repetitions in either location or identity (Fig. 1). Each run lasted 5 min, 36 s and consisted of 16 epochs (16 s each) with 5 fixation periods (16 s each) interleaved at regular intervals. During each epoch, 16 objects appeared, each shown for 725 ms followed by a 275 ms blank. Objects (each 12° × 12°) appeared in one of 8 locations within an overall area subtending 18° × 18° of visual angle. The order of the four categories was counterbalanced across runs. ROI selection. Regions of interests were functionally defined using two localizer scans, which included 16 epochs (16 s each) of passive viewing of faces or common objects centered on the screen (25 pictures per epoch). Each run began with 16 s of fixation, and an 8-s fixation period was included after every 2 passive viewing epochs. The right and left FFA and right OFA were defined as contiguous voxels activated at an arbitrary threshold of t = 2 in the middle fusiform gyri (c–d, F-G, 9-10 in Talairach space), and the same threshold was applied in the right ventral occipital lobe (c-d, H-I, nature neuroscience • volume 3 no 2 • february 2000
© 2000 Nature America Inc. • http://neurosci.nature.com
articles
© 2000 Nature America Inc. • http://neurosci.nature.com
9-10) for the right OFA . The raw data were noisier than when using a higher field scanner and a surface coil6,10 so the same level of significance for ROI definitions could not be applied. However, the magnitude and spatial extent of the effect for a given functional area should be similar regardless of statistical power, and we used a criterion leading to ROIs comparable in size to those in published studies6,10 . Our FFAs show at least twice as much percent signal change for faces as for objects (each compared to fixation.) To eliminate the influence of less face-selective voxels, we defined the ‘center of the right FFA’ using criteria more stringent than in any published study. The only voxels selected were found within the cluster of contiguous voxels selected using the less stringent criterion, showed twofold greater percentage signal change for faces as objects (compared with fixation) and, in each subject, did not have less than half the percentage signal change for faces of the voxel showing the maximum signal change for faces. fMRI imaging parameters and analyses. Most (16) subjects were scanned at the Yale School of Medicine on a 1.5 T GE Signa scanner equipped with resonant gradients (Advanced NMR, Wilmington, Massachusetts) using echo-planar imaging (gradient echo single shot sequence, 168 images per slice, FOV = 40 × 20 cm, matrix = 128 × 64, NEX = 1, TR = 2000 ms, TE = 60 ms, flip angle = 60 ms). Six contiguous 7-mm-thick axial-oblique slices aligned along the longitudinal extent of the fusiform gyrus covered most of the temporal lobe. Some subjects (two car experts and one bird expert) were scanned using coronal-oblique slices. Three more subjects (two car experts and 1 bird expert, I. G. et al., Soc. Neurosci. Abstr. 25, 212.9, 1999) were scanned using coronal slices on the 3 T GE scanner at the MGH-NMR Center in Charlestown, Massachusetts. In this case, a custom bilateral surface coil was used to collect 168 images per slice in 12 near-coronal slices, 6 mm-thick. The imaging parameters were TR = 2000 ms, TE = 70 ms, flip angle = 90°, 180 degrees and offset = 25 ms. Before statistical analysis, images from the 1.5 T scanner were motion corrected for three translation directions and the three possible rotations using SPM-96 software (Wellcome Department of Cognitive Neurology, London, UK). On the 3 T scanner, a bite bar was used to minimize head motion. Maps of t-values and percent signal change, both corrected for a linear drift in the signal38, were created. Maps were spatially smoothed using a Gaussian filter with a full-width half-maximum value of two voxels, except for analyses in the center of the right FFA, where regions of interests were very small and no smoothing was performed. In group composite maps, the percent signal change relative to fixation baseline for both birds and cars was multiplied with contrast weights for each subject (1 and –1 for bird experts and –1 and 1 for car experts). Under the null hypothesis of no expertise effect, the expected value for this contrast was equal to zero. We used a randomization test to asses the statistical significance of percent signal changes. A population distribution for each voxel was generated by calculating randomized mean values (1000 times) of the contrast in which randomly chosen subsets of half the subjects got reversed weights. The observed contrast, calculated without sign reversal, was assigned a p value or proportion of times that the observed contrast was more extreme than the randomized contrast). To show the anatomy clearly, the p values were overlaid on the normalized anatomical images for a single subject (threshold at p < 0.01; Fig. 6). Note: Additional analysis can be found on the Nature Neuroscience web site (http://neurosci.nature.com/web_specials/).
ACKNOWLEDGEMENTS We thank Nancy Kanwisher and René Marois for discussions and Jill Moylan, Terry Hickey and Hedy Sarofin for technical assistance. This work was supported by NINDS grant NS33332 to J.C.G. and NIMH grant 56037 to N. Kanwisher. I.G. was supported by NSERC.
RECEIVED 11 AUGUST; ACCEPTED 7 DECEMBER 1999 1. Archambault, A., O’Donnell, C. & Schyns, P. G. Blind to object changes: When learning the same object at different levels of categorization modifies its perception. Psychol. Sci. 10, 249–255 (1999). 2. Allison, T. et al. Face recognition in human extrastriate cortex. J. Neurophysiol. 71, 821–825 (1994).
nature neuroscience • volume 3 no 2 • february 2000
3. Gauthier, I., Tarr, M. J., Moylan, J., Anderson, A. W. & Gore, J. C. The functionallydefined ‘face area’ is engaged by subordinate-level recognition. Cognit. Neuropsychol. (in press). 4. Gauthier, I., Tarr, M. J., Anderson, A. W., Skudlarski, P. & Gore, J. C. Activation of the middle fusiform ‘face area’ increases with expertise in recognizing novel objects, Nat. Neurosci. 2, 568–573 (1999). 5. Haxby, J. V. et al. The functional organization of human extrastriate cortex: A PETRCBF study of selective attention to faces and locations. J. Neurosci. 14, 6336–6353 (1994). 6. Kanwisher, N., McDermott, J. & Chun, M. M. The fusiform face area: A module in human extrastriate cortex specialized for face perception. J. Neurosci. 17, 4302–4311 (1997). 7. McCarthy, G., Puce, A., Gore, J. C. & Allison, T. Face-specific processing in the human fusiform gyrus. J. Cogn. Neurosci. 9, 605–610 (1997). 8. Puce, A., Allison, T, Asgari, M, Gore, J. C. & McCarthy, G. Face-sensitive regions in extrastriate cortex studied by functional MRI. Neurophysiology 74, 1192–1199 (1996). 9. Sergent, J., Otha, S. & MacDonald, B. Functional neuroanatomy of face and object processing. Brain, 115, 15–36 (1992). 10. Kanwisher, N., Stanley, D. & Harris, A. The fusiform face area is selective for faces not animals. Neuroreport 10, 183–187 (1999). 11. Sergent, J. & Signoret, J. L. Varieties of functional deficits in prosopagnosia. Cereb. Cortex 2, 375–388 (1992). 12. McNeil, J. E. & Warrington, E. K. Prosopagnosia: A face-specific disorder. Q. J. Exp. Psychol. A 46, 1–10 (1993). 13. Moscovitch, M., Winocur, G. & Behrmann, M. What is special in face recognition? Nineteen experiments on a person with visual object agnosia and dyslexia but normal face recognition. J. Cogn. Neurosci. 9, 555–604 (1997). 14. Assal, G., Favre, C. & Anderes, J. P. Non-reconnaissance d’animaux familiers chez un paysan. Rev. Neurol. 140, 580–584 (1984). 15. Ishai, A, Ungerleider, L. G., Martin, A., Schouten, J. L. & Haxby, J. Distributed representation of objects in the human ventral visual pathway. Proc. Natl. Acad. Sci. USA 96, 9379–9384 (1999). 16. Tanaka, K. Inferotemporal cortex and object vision. Annu. Rev. Neurosci. 19, 109–139 (1996). 17. Bornstein, B. in Problems of Dynamic Neurology (ed. Halpern, L.) 283–318 (Hadassah Medical Organization, Jerusalem, 1963). 18. Lhermitte, J., Chain, F, Escouroole, R. Ducarne, B & Pillon, B. Étude anatomoclinique d’un cas de prosopagnosie. Rev. Neurol. (Paris) 126, 329–346 (1972). 19. Damasio, A. R. & Damasio, H. & Van Hoesen, G. W. Prosopagnosia: anatomic basis and behavioral mechanisms. Neurology 32, 331–341(1982). 20. Dixon, M. J., Bub, D. N. & Arguin, M. Semantic and visual determinants of face recognition in a prosopagnosic patient. J. Cogn. Neurosci. 10, 362–376 (1998). 21. Riddoch, J. M. & Humphreys, G. W. Visual processing in optic aphasia: A case of semantic access agnosia. Cognit. Neuropsychol. 4, 131–186 (1987). 22. Gauthier, I., Behrmann, M. & Tarr, M. J. Can face recognition really be dissociated from object recognition? J. Cogn. Neurosci. 11, 349–370 (1999). 23. Yin, R. K. Looking at upside-down faces. J. Exp. Psychol. 81, 141–145 (1969). 24. Tanaka, J. W. & Farah, M. J. Parts and wholes in face recognition. Q. J. Exp. Psychol. A 46, 225–245 (1993). 25. Farah, M. J., Wilson, K. D., Drain, H. M. & Tanaka, J. W. The inverted face inversion effect in prosopagnosia: Evidene for mandatory, face-specific perceptual mechanisms. Neuropsychologia 33, 661–674 (1995). 26. Diamond, R. & Carey, S. Why faces are and are not special: An effect of expertise. J. Exp. Psychol. Gen. 115, 107–117 (1986). 27. Gauthier, I. & Tarr, M. J. Becoming a ‘Greeble’ expert: Exploring the face recognition mechanisms. Vision Res. 37, 1673–1682 (1997). 28. Gauthier, I., Williams, P., Tarr, M. J. & Tanaka, J. W. Training ‘Greeble’ experts: A framework for studying expert object recognition processes. Vision Res. 38, 2401–2428 (1998). 29. deGelder, B., Bachoud-Lévi, A.-C. & Degos, J.-D. Inversion superiority in visual agnosia may be common to a variety of orientation-polarised objects besides faces. Vision Res. 38, 2855–2861 (1998). 30. Gauthier, I., Anderson, A. W., Tarr, M. J., Skudlarski, P. & Gore, J. C. Levels of categorization in visual object recognition studied with functional MRI. Curr. Biol. 7, 645–651 (1997). 31. Halgren E., Dale, A. M., Sereno, M. I., Tootell, R. B., Marinkovic, K. & Rosen, B. R. Location of human face-selective cortex with respect to retinotopic areas. Hum. Brain Mapp. 7, 29–37 (1999). 32. Rolls, E. T. & Baylis, G. C. Size and contrast have only small effects on the response to faces of neurons in the cortex of the superior temporal sulcus of the monkey. Exp. Brain Res. 65, 38–48 (1986). 33. Rosnow, R. L. & Rosenthal, R. “Some things you learn aren’t so”: Cohen’s paradox, Asch’s Paradigm, and the interpretation of interaction. Psychol. Sci. 6, 3–9 (1995). 34. Epstein, R., Harris, A., Stanley, D. & Kanwisher, N. The parahippocampal place area: Recognition, navigation, or encoding? Neuron 23, 115–125 (1999). 35. Puce, A., Allison, T, Asgari, M, Gore, J. C. & McCarthy, G. Differential sensitivity of human visual cortex to faces, letterstrings, and textures: A functional magnetic resonance imaging study, J. Neurosci. 16, 5205–5215 (1996). 36. Wojciulik, E., Kanwisher, N. & Driver, J. Modulation of activity in the fusiform face area by covert attention: an fMRI study. J. Neurophysiol. 79, 1574–1578 (1998). 37. Tranel, D., Logan, C. G., Frank, R. J. & Damasio, A. R. Explaining category-related effects in the retrieval of conceptual and lexical knowledge for concrete entities: operationalization and analysis of factors. Neuropsychologia 35, 1329–1339 (1997). 38. Skudlarski, P., Constable, R. T. & Gore, J. C. ROC analysis of statistical methods used in functional MRI: Individual subjects. Neuroimage 9, 311–329 (1999).
197